BACTERIA-MEDIATED GENE MODULATION VIA microRNA MACHINERY

a technology of microrna and gene modulation, applied in the direction of microorganisms, artificial cell constructs, drug compositions, etc., can solve the problem of mirna or its precursors being delivered into target cells, and achieve the effect of facilitating the delivery of mirna or its precursors

Inactive Publication Date: 2011-05-12
1GLOBE BIOMEDICAL CO LTD
View PDF17 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0012]In one aspect, the present invention provides a method of treating or preventing a disorder in an animal caused by at least one defective miRNA in the animal. The method includes infecting the cells of the animal with bacteria comprising a functional version of said miRNA, a RNA precursor to said functional miRNA, or a DNA molecule encoding at least said functional miRNA or said precursor.

Problems solved by technology

With many potential applications of miRNA for therapeutic purposes, however, one major obstacle has been the delivery of miRNA or its precursors into target cells.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • BACTERIA-MEDIATED GENE MODULATION VIA microRNA MACHINERY
  • BACTERIA-MEDIATED GENE MODULATION VIA microRNA MACHINERY
  • BACTERIA-MEDIATED GENE MODULATION VIA microRNA MACHINERY

Examples

Experimental program
Comparison scheme
Effect test

example 1

Bacterial Expression of pre-miRNA

[0149]A fragment of the human Let-7 miRNA (Let-7a) purchased from Integrated DNA Technologies, Inc. was cloned into the TMIR plasmid as described above.

[0150]The Let-7a DNA flanked by restriction enzyme sites (BamHI / SalI) has the following sequence (SEQ ID NO:9):

5′-GCGGATCCTGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACTGGGAGATAACTATACAATCTACTGTCTTTCCTAGTCGACCG-3′

[0151]Results of the mRNA assays are shown in FIG. 4. While the k-Ras mRNA level showed only slight decrease in cells treated with the Let-7a miRNA compared to the control (left), the decrease in k-Ras protein level was disproportionally pronounced (right), suggesting that while some mRNA degradation might have occurred, most of the gene modulation effect by the Let-7a miRNA was likely through translation repression, a hallmark of miRNA mechanism. These data clearly demonstrate that bacteria can mediate gene modulation via miRNA mechanism, through synthesizing and processing miRNA precursors....

example 2

Bacterial Expression of pri-miRNA

[0152]DNA sequence encoding pri-miRNA sequence of the human miR-155 miRNA is cloned into the TMIR plasmid. Bacterial transformation with the plasmid is carried out. In one example, processing of the pri-miRNA to pre-miRNA occurs in the bacteria with the expression of human Drosha either in the same TMIR plasmid as the pri-miRNA sequence or on a separate bacterial expression vector. In another example, pri-miRNA processing occurs in the infected eukaryotic cells without the need for bacterial Drosha expression.

[0153]Hela cells are then infected with the transformed bacteria and Bach1 mRNA and protein levels are analyzed using the assays described.

[0154]The miR-155 pri-miRNA sequence is as follows:

(SEQ ID NO: 10)5′-GTGGCACAAACCAGGAAGGGGAAATCTGTGGTTTAAATTCTTTATGCCTCATCCTCTGAGTGCTGAAGGCTTGCTGTAGGCTGTATGCTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATTACAGTGTATGATGCCTGTTACTAGCATTCACATGGAACAAATTGCTGCCGTGGGAGGATGACAAAGAAGCATGAGTCACCCTGCTGGATAAACT...

example 3

Bacterial Expression of miRNA Duplex

[0155]DNA sequences encoding two strands of a human miR-155 miRNA duplex is cloned into the TPIV® plasmid. Bacterial transformation with the plasmid is carried out. Hela cells are then infected with the transformed bacteria and k-Ras mRNA levels are analyzed using the assays described.

[0156]The miR-155 miRNA duplex sequences are as follows:

FOR 5′-TTAATGCTAATCGTGATAGGGG-3′(SEQ ID NO: 11)REV 5′-CCCCTATCACGATTAGCATTAA-3′(SEQ ID NO: 12)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Strain pointaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method of synthesizing, processing, and / or delivering miRNA or its precursors to eukaryotic cells using bacteria, preferably non-pathogenic or therapeutic strains of bacteria, to effect gene modulation in eukaryotic cells.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority to and the benefit of U.S. provisional patent application Ser. No. 60 / 947,311 filed Jun. 29, 2007, the content of which applications is incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION[0002]First discovered in Caenorhabditis elegans, microRNA (miRNA) have been found in plants and animals including humans. Encoded by genes transcribed from DNA but not translated into protein (non-protein-coding RNA), miRNAs have been found to regulate as much as more than 30% mammalian genes. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules and their main function is believed to be modulating gene expression.[0003]With many potential applications of miRNA for therapeutic purposes, however, one major obstacle has been the delivery of miRNA or its precursors into target cells. A new method is needed for safe and predictable administration of miRNAs to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/071C12N15/63C12N1/21C12N5/02
CPCC12N15/111C12N15/1135C12N15/113C12N2310/141C12N2320/32C12N2310/111A61P31/12A61P35/00
InventorLI, CHIANG
Owner1GLOBE BIOMEDICAL CO LTD