Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Modulation of transthyretin expression

a technology of transthyretin and expression, applied in the field of modulation of transthyretin expression, can solve the problems of ganglionic site neuronal loss, axonal degeneration, and not without problems

Inactive Publication Date: 2011-12-01
IONIS PHARMA INC
View PDF5 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0011]Provided herein are methods, compounds, and compositions for modulating expression of transthyretin (TTR) mRNA and protein. In certain embodiments, compound

Problems solved by technology

Following TTR deposition, axonal degeneration occurs, starting in the unmyelinated and myelinated fibers of low diameter, and ultimately leading to neuronal loss at ganglionic sites.
While liver transplantation is effective as a form of gene therapy it is not without its problems.
Transplantation is complicated by the need for invasive surgery for the recipient and the donor, long-term post-transplantation immunosuppressive therapy, a shortage of donors, its high cost, and the large number of TTR amyloidosis patients that are not good candidates because of their disease progression.
Unfortunately, cardiac amyloidosis progresses in some familial patients even after liver transplantation because WT TTR often continues to deposit.
Transplantation is not a viable option for the most prevalent TTR disease, senile systemic amyloidosis (SSA), affecting approximately 25% of those over 80 due to the deposition of WT TTR.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modulation of transthyretin expression
  • Modulation of transthyretin expression
  • Modulation of transthyretin expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

Antisense Inhibition of Human Transthyretin in HepG2 Cells

[0467]Antisense oligonucleotides were designed targeting a transthyretin nucleic acid and were tested for their effects on transthyretin mRNA in vitro. Cultured HepG2 cells at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS1396 (forward sequence CCCTGCTGAGCCCCTACTC, designated herein as SEQ ID NO: 5; reverse sequence TCCCTCATTCCTTGGGATTG, designated herein as SEQ ID NO: 6; probe sequence ATTCCACCACGGCTGTCGTCAX, designated herein as SEQ ID NO: 7). Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of transthyretin, relative to untreated control cells.

[0468]The chimeric antisense oligonucl...

example 2

Antisense Inhibition of Human Transthyretin in HepG2 Cells by Oligonucleotides Designed by Microwalk

[0472]Additional gapmers were designed based on the gapmers presented in Table 3 that demonstrated an inhibition of at least 50%. These gapmers were designed by creating gapmers shifted slightly upstream and downstream (i.e. “microwalk”) of the original gapmers from Table 3. Gapmers were also created with various motifs, e.g. 5-10-5 MOE, 3-14-3 MOE, 2-13-5 MOE, and 4-11-5 MOE motifs. These gapmers were tested in vitro. Cultured HepG2 cells at a density of 10,000 cells per well were transfected using lipofectin reagent with 50 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3029 was used to measure transthyretin mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGRE...

example 3

Dose-Dependent Antisense Inhibition of Human Transthyretin in HepG2 Cells

[0480]Gapmers from Example 2 exhibiting significant in vitro inhibition of human transthyretin were tested at various doses in HepG2 cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM and 10000 nM concentrations of antisense oligonucleotide, as specified in Table 5. After a treatment period of approximately 16 hours, RNA was isolated from the cells and transthyretin mRNA levels were measured by quantitative real-time PCR. Human transthyretin primer probe set RTS3029 was used to measure mRNA levels. Transthyretin mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of transthyretin, relative to untreated control cells.

[0481]The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented in Table 5 and was calculated by plot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Molar densityaaaaaaaaaa
Login to View More

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of transthyretin mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate transthyretin amyloidosis, or a symptom thereof.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 61 / 329,538, filed Apr. 29, 2010 and U.S. Provisional Application No. 61 / 405,163, filed Oct. 20, 2010. Each of the above applications is herein incorporated by reference in its entirety.SEQUENCE LISTING[0002]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0123WOSEQ.txt created Apr. 28, 2011, which is 55 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.FIELD OF THE INVENTION[0003]Provided herein are methods, compounds, and compositions for reducing expression of transthyretin mRNA and protein in an animal. Such methods, compounds, and compositions are useful, for example, to treat, prevent, or ameliorate transthyretin amyloidosis.BACKGROUND OF THE INVENTION[0004]Transthyret...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/712A61P25/00A61P27/06A61P3/00A61P27/02A61P25/08A61P9/00A61P1/16A61P9/04A61P7/10A61P11/00A61P1/08A61P7/04A61P1/12A61P15/10A61P9/06A61P13/00C07H21/04
CPCC12N15/113C12N2310/14C12N2310/315A61K31/712C12N2310/341C12N2310/321C12N2310/3521A61P1/08A61P1/10A61P1/12A61P1/16A61P11/00A61P13/00A61P15/00A61P15/10A61P19/10A61P21/00A61P25/00A61P25/02A61P25/08A61P25/18A61P25/20A61P25/22A61P25/24A61P25/28A61P27/02A61P27/06A61P3/00A61P7/00A61P7/04A61P7/10A61P9/00A61P9/04A61P9/06A61P3/10A61K48/00C07H21/04C12N15/11C12N2310/11C12N2310/3341C12N2310/52C12N2320/30
Inventor MONIA, BRETT P.FREIER, SUSAN M.SIWKOWSKI, ANDREW M.
Owner IONIS PHARMA INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com