Highly effective Anti-cadherin antibody for induction of antibody-dependent cellular cytotoxicity in vivo
a technology of anti-cadherin and cellular cytotoxicity, which is applied in the field of anti-cadherin antibody, can solve the problems of unsatisfactory therapeutic needs of patients, suggesting the association of the level of adcc activity, and achieve the effect of high antibody-dependent cellular cytotoxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Establishment of CDH3-Expressing CHO Cell Line
[0090]In order to obtain a cell line used in the screening of an anti-CDH3 antibody, CHO cells that expressed full-length CDH3 were established.
(1) Preparation of Expression Vector for CDH3 Gene
[0091]In order to insert full-length human CDH3 DNA shown in SEQ ID NO: 1 into a mammalian expression vector pEF4 / myc-HisB (Invitrogen), the DNA was treated with two types of restriction enzymes KpnI (Takara Bio Inc.) and XbaI (Takara Bio Inc.) at 37° C. for 1 hour, and it was then inserted into pEF4 / myc-HisB treated with the same KpnI and XbaI according to an ordinary method using T4 DNA ligase (Promega), so as to obtain an expression vector pEF4-CDH3-myc-His.
(2) Achievement of CDH3 Stably Expressing Cell Line
[0092]In accordance with the protocols of FuGENE (registered trademark) 6 transfection reagent (Roche Diagnostics), on the day before transfection, CHO cells (8×105 cells) were inoculated on a dish with a diameter of 10 cm, and they were the...
example 2
Preparation of Soluble CDH3 Antigen
[0094]A soluble CDH3 (sCDH3) protein, in which its C-terminal transmembrane region and the subsequent regions were deleted, was prepared to be used as an immunogen in the production of an anti-CDH3 antibody.
(1) Preparation of Expression Vector for Soluble CDH3 Antigen
[0095]Using full-length CDH3 cDNA as a template, a PCR reaction was carried out employing a forward primer (SEQ ID NO. 7: CGCGGTACCATGGGGCTCCCTCGT (hCDH3 Full FW)) and a reverse primer (SEQ ID NO. 8: CCGTCTAGATAACCTCCCTTCCAGGGTCC (hCDH3 Solb RV)) that had been designed to amplify a region corresponding to a CDH3 extracellular region (which corresponds to 1-654 of SEQ ID NO: 2; hereinafter referred to as sCDH3 cDNA). KOD-Plus (Toyobo Co., Ltd.) was used in the reaction, and the reaction was carried out under reaction conditions consisting of 30 cycles of 94° C.-15 seconds, 55° C.-30 seconds and 68° C.-90 seconds.
[0096]Thereafter, a gel fragment containing an approximately 2.0 kbp band t...
example 3
Production of Anti-CDH3 Monoclonal Antibody
(1) Preparation of Monoclonal Antibody Using Soluble CDH3 Protein as Immunogen
[0100]50 μg of a soluble CDH3 protein dissolved in a normal saline and Titer-MAX Gold (registered trademark) (TiterMax) were mixed at equal volume. The obtained mixture was injected into the abdominal cavity and subcutis of an MRL / lpr mouse (Japan SLC, Inc.) so as to carry out initial immunization. The second immunization and the subsequent immunizations were carried out by mixing a soluble CDH3 protein (protein amount: 25 μg) that had been prepared in the same manner as described above with Titer-MAX gold and then injecting the obtained mixture into the abdominal cavity and subcutis of the mouse. Three days after the final immunization, splenic cells were aseptically prepared from the mouse, and the splenic cells were then fused with mouse myeloma cells SP2 / O-Ag14 or P3-X63-Ag8.653 according to an ordinary method (polyethylene glycol method).
(2) Selection of Anti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More