Selective reduction of allelic variants

a technology of allelic variants and selective reduction, applied in the field of selective reduction of allelic variants, can solve the problems of negative consequences of reducing the expression of huntingtin from wild type alleles, and achieve the effect of reducing the expression of an allelic varian

Inactive Publication Date: 2015-10-15
IONIS PHARMA INC
View PDF4 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Reduction of huntingtin expression from the wild type allele may, therefore, have negative consequences.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Selective reduction of allelic variants
  • Selective reduction of allelic variants
  • Selective reduction of allelic variants

Examples

Experimental program
Comparison scheme
Effect test

example 1

Single Nucleotide Polymorphisms (SNPs) in the Huntingtin (HTT) Gene Sequence

[0357]The HTT genomic sequence, designated herein as SEQ ID NO: 1 (NT—006081.18 truncated from nucleotides 1566000 to 1768000) was aligned with the HTT mRNA, designated herein as SEQ ID NO: 2 (NM—002111.6), using the EMBL-EBI sequence database (ClustalW2, http: / / www.ebi.ac.uk / Tools / clustalw2 / index.html), and the output is presented in FIG. 1. SNP positions (identified by Hayden et al, WO / 2009 / 135322) associated with the HTT gene were mapped to the two sequences and have been demarcated in FIG. 1 by their reference SNP ID number from the Entrez SNP database at the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / sites / entrez?db=snp), incorporated herein by reference. Table 2 furnishes further details on each SNP. The ‘Reference SNP ID number’ or ‘RS number’ is the number designated to each SNP from the Entrez SNP database at NCBI, incorporated herein by reference. ‘SNP position...

example 2

Design of Antisense Oligonucleotides Targeting Huntingtin Gene SNPs and Inhibition of HTT mRNA in Coriell Fibroblast Cell Lines (GM04281, GM02171, and GM02173B)

[0358]Antisense oligonucleotides targeting nucleotides overlapping SNP positions presented in Table 1 were designed and tested for potency in three huntingtin patient-derived Coriell fibroblast cell lines, GM04281, GM02171, and GM02173B (from the Coriell Institute for Medical Research). Cultured GM04281 cells or GM02171 cells or GM02173B cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real time PCR using primer probe set RTS2617 (forward sequence CTCCGTCCGGTAGACATGCT, designated herein as SEQ ID NO: 3; reverse sequence GGAAATCAGAACCCTCAAAATGG, designated herein as SEQ ID NO: 4; probe sequence TGAGCACTGTTCAACTGTGGATATCG...

example 3

Dose-Dependent Antisense Inhibition of Human Huntingtin mRNA Levels in Coriell Fibroblast Cell Lines

[0362]Gapmers from the study described in Example 2 were selected and tested at various doses in GM04281, GM02171, and GM02173B cell lines. Each cell line was plated at a density of 25,000 cells per well and transfected using electroporation with 750 nM, 1,500 nM, 3,000 nM, 6,000 nM, and 12,000 nM concentrations of antisense oligonucleotide, as specified in Table 5, 6, and 7. After a treatment period of approximately 16 hours, RNA was isolated from the cells and HTT mRNA levels were measured by quantitative real-time PCR. Human HTT primer probe set RTS2617 was used to measure mRNA levels. HTT mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of HTT mRNA, relative to untreated control cells. IC50 values are also provided in Tables 5, 6, and 7.

TABLE 5Dose-dependent antisense inhibition of human HTT in GM04281 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentrationsaaaaaaaaaa
Login to view more

Abstract

Disclosed herein are antisense compounds and methods for selectively reducing expression of an allelic variant of a huntingtin gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate Huntington's Disease (HD).

Description

SEQUENCE LISTING[0001]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0125USC1SEQ_ST24.txt created Mar. 3, 2015, which is 344 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.FIELD OF THE INVENTION[0002]Embodiments of the present invention provide methods, compounds, and compositions for selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate Huntington's Disease.BACKGROUND OF THE INVENTION[0003]Genetic diseases are caused by abnormalities in genes or chromosomes. Such abnormalities may include insertions, deletions, and expansions. Huntington's Disease (HD) is one example of a genetic disease caused by an expansion. HD is a progressive neurodegenerative disorder t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/158C12Q2600/136C12Q2600/156C12N2310/11C12N2320/34C12Q1/6897C12Q1/6811C12N15/113A61P25/14A61P25/28C12Q2525/207C12Q2535/131C12Q2539/107C12Q2521/327C12Q2525/121C12Q2525/185
Inventor BENNETT, C. FRANKHAYDEN, MICHAELFREIER, SUSAN M.GREENLEE, SARAHCARROLL, JEFFREYWARBY, SIMONSWAYZE, ERIC E.
Owner IONIS PHARMA INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products