Unlock instant, AI-driven research and patent intelligence for your innovation.

Rna-editing oligonucleotides and uses thereof

a technology of oligonucleotides and oligonucleotide, which is applied in the field of rna-editing oligonucleotides, can solve the problems that previously disclosed methods have not been shown to have the required selectivity and/or stability to allow for their use as therapies, and achieve the effect of reducing symptoms or other parameters related to disorders

Pending Publication Date: 2020-12-10
KORRO BIO INC
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent describes a method for editing RNA using enzymes called adenosine deaminases that act on double-stranded RNA. These enzymes recognize specific structural motifs of RNA and edit adenosine to reccode amino acid codons that may lead to changes in the encoded protein and its function. The patent discusses the use of guide oligonucleotides that can recruit adenosine deaminases to specific sites of selected transcripts and increase the efficiency of editing. The patent also describes the use of nucleobases and chemical modifications that can improve the recruitment of adenosine deaminases and enhance the editing of target RNA. The patent also mentions the use of nucleotides that are resistant to degradation by nucleases, which can increase the stability of oligonucleotides. The patent further explains that the treatment can be therapeutic or preventive, aiming to alleviate symptoms, stabilize the condition, or improve the quality of life.

Problems solved by technology

However, the previously disclosed methods have not been shown to have the required selectivity and / or stability to allow for their use as therapies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rna-editing oligonucleotides and uses thereof
  • Rna-editing oligonucleotides and uses thereof
  • Rna-editing oligonucleotides and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Guide Oligonucleotides with Novel Nucleotide Modifications Targeting Human RAB7A 3′-UTR Target (UAG)

Guide Oligonucleotide Targeting Human RAB7A (3′-UTR):

[0311]

(SEQ ID NO: 935′CAGAGUGUUACUCAGAAUUGGGAAAUCCAGCUAGCGGCAGUAUUCUGUACAGUAGACACAAGAAUUAUGUACGCCUUUUAUCAAAGAC-3′(SEQ ID NO: 94)3′-CCCUUUAGGUCGACCGCCGUCAUAAGACAUGUCAUCUGGGUUCUUAAUAC-5′

[0312]Shown in Table 6 below are exemplary modified guide oligonucleotides targeting human RAB7A with UAG triplet. In Table 6, A, C, G and U are ribonucleosides; underlined and bolded is the central triplet; mA, mC, mG and mU are 2′-O-methyl ribonucleosides; fC represents 2‘-deoxy’-2′-fluoro-arabinocytidine (Formula I: R1=fluoro and N=cytosine); fA represents 2′-deoxy-2′-fluoro-arabinoadenosine (Formula I: R1=fluoro and N1=adenine); aC represents arabinocytidine (Formula I: R1=hydroxy and N1=cytosine); aA represents arabinoadenosine (Formula I: R1=hydroxy and N1=adenine); amC represents 2′-O-methyl-arabinocytidine (Formula I: R=methoxy and N1=cytosine)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
structureaaaaaaaaaa
sizeaaaaaaaaaa
stabilityaaaaaaaaaa
Login to View More

Abstract

The present disclosure features useful compositions and methods to treat disorders for which deamination of an adenosine in an mRNA produces a therapeutic result, e.g., in a subject in need thereof.

Description

[0001]This application claims priority to U.S. Provisional Patent Application Nos. 62 / 795,357, filed Jan. 22, 2019, 62 / 822,472, filed Mar. 22, 2019, and 62 / 900,019 filed Sep. 13, 2019, each of which is incorporated by reference herein in its entirety for any purpose.REFERENCE TO SEQUENCE LISTING[0002]The present application contains a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled “2020-08-11_01249-0004-00US_Seq_List_ST25.txt” created on Aug. 11, 2020, which is 61,440 bytes in size.BACKGROUND[0003]Adenosine deaminases acting on RNA (ADAR) are enzymes which bind to double-stranded RNA (dsRNA) and convert adenosine to inosine through deamination. In RNA, inosine functions similarly to guanosine for translation and replication. Thus, conversion of adenosine to inosine in an mRNA can result in a codon change that may lead to changes to the encoded protein and its functions. There are three known ADAR proteins expressed in humans, ADAR1, ADAR2,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/11A61K31/7125
CPCC12N2310/315C12N15/11A61K31/7125C12N2310/321C07H21/00C12N15/1137C12N2310/20C12Y306/05002C12N2310/322C12N2310/334C12N2310/3231C12N2310/3521C12N2310/3533C12N2310/3525A61K47/543A61K47/549A61K31/7088C12Y305/04004A61K47/55
Inventor FRALEY, ANDREW W.ROBINETTE, STEVENBERMINGHAM, NESSANPUTTA, MALLIKARJUNA REDDY
Owner KORRO BIO INC