Method for quantitative analyzing evolution of RNA structure steadiness
A technology for RNA structure and quantitative analysis, applied in the field of computer programs, can solve problems such as difficult quantification and robustness evolution evaluation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0025] Fig. 1 is an overall block diagram of a method for quantitatively analyzing the evolution of RNA structure robustness according to the present invention.
[0026] For the RNA sequence input from the computer terminal, the legality check is performed according to the definition of the RNA sequence. The RNA sequence is a string R=r taken from the alphabet A={A,C,G,U} 1 , r 2 ,...,r n , where r i ∈A, i=1, 2, . . . , n. For input sequences that do not conform to this definition, return to re-input. Adopt the present invention, the example of analysis is the sequence of the microRNA let-7 precursor that length is 1=99 in the nematode:
[0027] UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGU
[0028] GAACUAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA
[0029] After checking the legitimacy of the RNA sequence input from the computer terminal, along the Hamming distance of the input RNA sequence, select a completely random scrambling method among the five scrambling me...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
