Aqueous monomer emulsionss containing hydrophobin
A technology of hydrophobic protein and hydrophobic monomer, which is used in emulsion as a feeding material in suspension polymerization. The expandable or expandable thermoplastic obtained by this method can be used to prepare these emulsions and the field of inorganic particle suspension polymerization, which can solve the difficulty of emulsion operation. , Impossible to use the pump to transport and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0132] Example 1: Cloned yaad-His 6 / yaaE-His 6 Preparation
[0133] Polymerase chain reaction was performed with oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573). The template DNA used was Bacillus subtilis genomic DNA. The obtained PCR fragment contained the coding sequence of the Bacillus subtilis yaaD / yaaE gene, and NcoI or BglII restriction cleavage sites at its ends, respectively. The PCR fragment was purified and cut with restriction enzymes NcoI and BglII. This DNA fragment was used as an insert cloned into the vector pQE60 from Qiagen, which was previously linearized with the restriction enzymes NcoI and BglII. The vectors pQE60YAAD#2 / pQE60YaaE#5 thus obtained were used to express 6 and YAAE::HIS 6 of protein.
[0134] Hal570: gcgcgcccatggctcaaacaggtactga
[0135] Hal571: gcagatctccagccgcgttcttgcatac
[0136] Hal572: ggccatgggattaacaataggtgtactagg
[0137] Hal573: gcagatcttacaagtgccttttgcttatattcc
Embodiment 2
[0138] Example 2: yaad hydrophobin DewA-His 6 clone
[0139] Polymerase chain reaction was performed with oligonucleotides KaM416 and KaM417. The template DNA used was A. nidulans genomic DNA. The obtained PCR fragment contained the coding sequence of the hydrophobin gene dewA, and the N-terminal factor Xa protease cleavage site. The PCR fragment was purified and cut with the restriction enzyme BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD#2, which was previously linearized with the restriction enzyme BglII.
[0140] The vector #508 thus obtained was used to express the 6 composed of fusion proteins.
[0141] KaM416:
[0142] GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
[0143] KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
Embodiment 3
[0144] Example 3: yaad hydrophobin RodA-His 6 clone
[0145] Plasmid #513 was cloned similarly to plasmid #508 using oligonucleotides KaM434 and KaM435.
[0146] KaM434:
[0147] GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTTCTCCATTGCTGC
[0148] KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 