Unlock instant, AI-driven research and patent intelligence for your innovation.

Aqueous monomer emulsionss containing hydrophobin

A technology of hydrophobic protein and hydrophobic monomer, which is used in emulsion as a feeding material in suspension polymerization. The expandable or expandable thermoplastic obtained by this method can be used to prepare these emulsions and the field of inorganic particle suspension polymerization, which can solve the difficulty of emulsion operation. , Impossible to use the pump to transport and other problems

Inactive Publication Date: 2010-06-16
BASF SE
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, they have a tendency to foam, which makes the handling of emulsions more difficult and, for example, makes pumping impossible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aqueous monomer emulsionss containing hydrophobin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0132] Example 1: Cloned yaad-His 6 / yaaE-His 6 Preparation

[0133] Polymerase chain reaction was performed with oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573). The template DNA used was Bacillus subtilis genomic DNA. The obtained PCR fragment contained the coding sequence of the Bacillus subtilis yaaD / yaaE gene, and NcoI or BglII restriction cleavage sites at its ends, respectively. The PCR fragment was purified and cut with restriction enzymes NcoI and BglII. This DNA fragment was used as an insert cloned into the vector pQE60 from Qiagen, which was previously linearized with the restriction enzymes NcoI and BglII. The vectors pQE60YAAD#2 / pQE60YaaE#5 thus obtained were used to express 6 and YAAE::HIS 6 of protein.

[0134] Hal570: gcgcgcccatggctcaaacaggtactga

[0135] Hal571: gcagatctccagccgcgttcttgcatac

[0136] Hal572: ggccatgggattaacaataggtgtactagg

[0137] Hal573: gcagatcttacaagtgccttttgcttatattcc

Embodiment 2

[0138] Example 2: yaad hydrophobin DewA-His 6 clone

[0139] Polymerase chain reaction was performed with oligonucleotides KaM416 and KaM417. The template DNA used was A. nidulans genomic DNA. The obtained PCR fragment contained the coding sequence of the hydrophobin gene dewA, and the N-terminal factor Xa protease cleavage site. The PCR fragment was purified and cut with the restriction enzyme BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD#2, which was previously linearized with the restriction enzyme BglII.

[0140] The vector #508 thus obtained was used to express the 6 composed of fusion proteins.

[0141] KaM416:

[0142] GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC

[0143] KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC

Embodiment 3

[0144] Example 3: yaad hydrophobin RodA-His 6 clone

[0145] Plasmid #513 was cloned similarly to plasmid #508 using oligonucleotides KaM434 and KaM435.

[0146] KaM434:

[0147] GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTTCTCCATTGCTGC

[0148] KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to emulsions of hydrophobic monomers in inorganic particles, which contain water and which act as pickering emulsifiers, and hydrophobin, as well as to the production and use ofthese emulsions.

Description

technical field [0001] The present invention relates to emulsions of hydrophobic monomers in water comprising inorganic particles acting as solid stabilizing emulsifiers (Pickering emulsifiers) and hydrophobins, and also to processes for the preparation of these emulsions in which monomers are present in the presence of inorganic particles acting as solid stabilizing emulsifiers Dispersed in water in the presence of co-used hydrophobin. [0002] The invention also relates to the use of hydrophobins for the preparation of emulsions of hydrophobic monomers in water and to a process for the suspension polymerization of hydrophobic monomers in water with co-used inorganic particles as solid stabilizing emulsifiers, in which hydrophobins are co-used. [0003] In addition, the invention relates to the use of emulsions as feed material in suspension polymerizations. [0004] Finally, the invention relates to a process for producing expandable or expandable thermoplastic polymer part...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C08F2/22C08F2/18C09K23/30
CPCC08F2/22C08F2/18C08F212/08C08J3/02
Inventor A·昆勒C·埃克斯纳C·博尔施韦勒T·萨布科夫斯基U·鲍斯H-G·勒迈尔M·考罗什
Owner BASF SE