Carrier of reverse gene system for construction of influenza virus and application thereof
A technology of influenza virus and vector, applied in the field of reverse genetic system, can solve the problems of time-consuming, cumbersome steps, and unsatisfactory connection efficiency, and achieve the effects of simplified rescue steps, simple construction process, and good reproductive characteristics
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1, construction of pLLB-A and pLLB-G vectors
[0037] 1) Construction of pBackbone-vector vector
[0038] The sequences of primers pBackbone-BGH-upstream and pBackbone-BGH-downstream, pBackbone-CMV-upstream and pBackbone-CMV-downstream are designed as follows:
[0039] pBackbone-BGH-upstream: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG3';
[0040] pBackbone-BGH-downstream: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG3'.
[0041] pBackbone-CMV-upstream: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT3';
[0042] pBackbone-CMV-downstream: 5'CTCGAGGATATCTGCAGAATTCCAGCACAC3'.
[0043] The primers were synthesized by Shanghai Shenggong Company and purified by PAGE. When in use, it was prepared to a working concentration of 20 μM, aliquoted, and frozen at -80°C for later use.
[0044] Using the pEGFP-N1 plasmid as a template, use primers pBackbone-BGH-upstream and pBackbone-BGH-downstream to PCR amplify Fragment A; use pCDNA3.0 plasmid as a template, use primers pBackbone-CMV-upstream and pBackbone...
Embodiment 2
[0064] Embodiment 2, construct the reverse genetic system of influenza virus with pLLB-A and pLLB-G
[0065] 1) Use pLLB-A and pLLB-G to construct a reverse genetics system for influenza virus
[0066] The pLLB-A and pLLB-G vectors were digested and linearized with StuI endonuclease, respectively, and the linearized pLLB-A and pLLB-G vectors were recovered.
[0067] The enzyme digestion system is as follows: 10×D buffer 10μl, BSA 1μl, StuI 2μl (20U PROMEGA company), pLLB-A and pLLB-G 10ug respectively, rehydrated to 100μl, 37°C enzyme digestion overnight.
[0068] The digested product was electrophoresed on agarose gel prepared by 1×TAE, 120v, electrophoresis for 30 minutes, the target fragment was recovered with a DNA recovery kit, and the recovered product was stored at -80°C for later use.
[0069] The RNA of three subtype influenza viruses (H1N1, H9N2 and H11N9) was extracted respectively, reverse transcribed into cDNA, and primers P1-1 and P1-2 were designed to amplify t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap