Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Carrier of reverse gene system for construction of influenza virus and application thereof

A technology of influenza virus and vector, applied in the field of reverse genetic system, can solve the problems of time-consuming, cumbersome steps, and unsatisfactory connection efficiency, and achieve the effects of simplified rescue steps, simple construction process, and good reproductive characteristics

Inactive Publication Date: 2011-08-31
CHINA AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the process of constructing the eight gene fragment plasmids of influenza virus, the existing influenza reverse genetics system plasmids are connected by traditional ligation method, first cut with restriction endonuclease, and then use T4DNA ligase Connection, the traditional enzyme digestion connection method has problems such as low connection efficiency and cumbersome steps. The PCR product and the carrier must go through repeated enzyme digestion, electrophoresis, recovery and other steps before further connection can be carried out.
This is time-consuming, and the efficiency of the connection is not ideal

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carrier of reverse gene system for construction of influenza virus and application thereof
  • Carrier of reverse gene system for construction of influenza virus and application thereof
  • Carrier of reverse gene system for construction of influenza virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, construction of pLLB-A and pLLB-G vectors

[0037] 1) Construction of pBackbone-vector vector

[0038] The sequences of primers pBackbone-BGH-upstream and pBackbone-BGH-downstream, pBackbone-CMV-upstream and pBackbone-CMV-downstream are designed as follows:

[0039] pBackbone-BGH-upstream: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG3';

[0040] pBackbone-BGH-downstream: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG3'.

[0041] pBackbone-CMV-upstream: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT3';

[0042] pBackbone-CMV-downstream: 5'CTCGAGGATATCTGCAGAATTCCAGCACAC3'.

[0043] The primers were synthesized by Shanghai Shenggong Company and purified by PAGE. When in use, it was prepared to a working concentration of 20 μM, aliquoted, and frozen at -80°C for later use.

[0044] Using the pEGFP-N1 plasmid as a template, use primers pBackbone-BGH-upstream and pBackbone-BGH-downstream to PCR amplify Fragment A; use pCDNA3.0 plasmid as a template, use primers pBackbone-CMV-upstream and pBackbone...

Embodiment 2

[0064] Embodiment 2, construct the reverse genetic system of influenza virus with pLLB-A and pLLB-G

[0065] 1) Use pLLB-A and pLLB-G to construct a reverse genetics system for influenza virus

[0066] The pLLB-A and pLLB-G vectors were digested and linearized with StuI endonuclease, respectively, and the linearized pLLB-A and pLLB-G vectors were recovered.

[0067] The enzyme digestion system is as follows: 10×D buffer 10μl, BSA 1μl, StuI 2μl (20U PROMEGA company), pLLB-A and pLLB-G 10ug respectively, rehydrated to 100μl, 37°C enzyme digestion overnight.

[0068] The digested product was electrophoresed on agarose gel prepared by 1×TAE, 120v, electrophoresis for 30 minutes, the target fragment was recovered with a DNA recovery kit, and the recovered product was stored at -80°C for later use.

[0069] The RNA of three subtype influenza viruses (H1N1, H9N2 and H11N9) was extracted respectively, reverse transcribed into cDNA, and primers P1-1 and P1-2 were designed to amplify t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a carrier used for constructing a reverse genetic system of influenza virus and applications thereof. The carrier is an annular carrier, which comprises a prokaryon replication origin, a selective marker gene, polyadenylid acid tailing signals and two promoters sharing an identical transcription direction. The polyadenylid acid tailing signals are positioned at the downstreams of the two promoters with opposite transcription directions, wherein, a pol I element is positioned between the two promoters sharing an identical transcription direction and the polyadenylid acid tailing signals and comprises an RNA polymerase I promoter, a connecting segment and an RNA polymerase I terminator from the upstream to the downstream sequentially, and the connecting segment comprises one of the following first or second sequence: firstly, GGGGAGCGAAAGCAGG; and secondly, GGTTATTAGTAGAAACAAGG. The carrier can be used for constructing the reverse genetic system plasmid of the influenza virus for rescuing virus.

Description

technical field [0001] The invention relates to a carrier and application for constructing a reverse genetic system of influenza virus. Background technique [0002] Frequent outbreaks of avian influenza not only bring huge economic losses to the breeding industry, but also pose a huge threat to human health. At present, the research on avian influenza, especially the research on highly pathogenic avian influenza of H5N1 subtype is deepening day by day, and great progress has been made in its pathogenic mechanism, cross-species transmission mechanism, vaccine research and so on. The research on the molecular mechanism of influenza virus has benefited from the establishment of the influenza virus reverse genetic system in recent years. The establishment of this system allows researchers to conduct mutation research on the influenza virus genome at the molecular level. This technology has also greatly improved the level of understanding of influenza viruses, and the currently...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/64C12N15/44
Inventor 刘金华刘芹防马广鹏蒲娟王帅
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com