Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Use of ShRNA in preparing medicament for improving survival ratio of xenogenic organ transplantation

A technology of allogeneic transplantation and survival rate, applied in the field of molecular immunity, can solve problems such as nephrotoxicity, and achieve the effects of strong renal side toxicity, prolonging survival time, and small toxic side effects

Inactive Publication Date: 2009-04-22
WUHAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of ShRNA in preparing medicament for improving survival ratio of xenogenic organ transplantation
  • Use of ShRNA in preparing medicament for improving survival ratio of xenogenic organ transplantation
  • Use of ShRNA in preparing medicament for improving survival ratio of xenogenic organ transplantation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The application of small molecular interfering RNA in the preparation of medicines for prolonging the survival rate of allogeneic organ transplantation, the steps are:

[0033] 1. Selection of target sequence: According to the gene sequence of Core1 beta 1,3-galactosyltransferase (AF157962) provided by GeneBank, the homology and RNA secondary structure were analyzed by BLAST and RNA structure 3.5 respectively, and a 21nt nucleoside was selected The acid sequence 5'-GCGAAGATTTAAGCCCTATGT-3' is used as the target sequence (a construction method and application of an shRNA expression vector that inhibits core1 β1-3 galactosyltransferase. In 2006, Wuhan University applied for a Chinese invention patent, and the application patent number was 200610019901.0, Inventors are Zhang Xiaolian, Zhou Xia).

[0034] 2. Design and synthesize primers. The primer sequences are: Oligo1.5'GCGAAGATTTAAGCCCTATGTTTCA 3'; Oligo2.5'AGCTTGAAACATAGGGCTTAAATCTTCGCGGCC 3'; Oligo3.5'AGCTTACATAGGGCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of ShRNA to preparation of a medicine for prolonging the survival rate of the transplantation of xenogenic organs. Small interfering RNA can specifically inhibit Core1 beta 1, 3 galactosyltransferase which is a key enzyme during the synthesis process of Core1O- polysaccharide. The small interfering RNA can inhibit the activation of CD8+T cells in a human body, has no influence on CD4+T cells and other immune cells, and can prolong the survival time of the transplantation of the xenogenic organs (such as skin) by inducing the apoptosis of CD3<+>CD8<+>T cells and strengthening the secretion of immunosuppressive cell factors IL-10 and so on. The small interfering RNA has the advantages that the small interfering RNA has small toxic side effect, only changes the synthesis of saccharide, does not affect the synthesis of protein and nucleic acid of cells, has low cost, is steady, and has strong capability of inhibiting rejection reactions of organ transplantation. The application has the advantages of high efficiency, high stability, and high specificity.

Description

technical field [0001] The present invention belongs to the field of molecular immunization. It specifically relates to the application of a small molecular interference RNA in the preparation of medicines for prolonging the survival rate of allogeneic organ transplantation. Background technique [0002] Immunosuppressants are used to prevent rejection in organ transplantation, that is, to interfere with the receptor's recognition of foreign antigens and the removal of non-self cells. Commonly used immunosuppressants are cyclosporine, corticosteroids, alkylating agents and antimetabolites. These drugs are characterized by poor selectivity and suppressive effects on both normal and abnormal immune responses. [1] CsA and its analogs (CsG, SDZIMM125) and Tacrolimus (FK506) are cytokine synthesis inhibitors that inhibit T cell cytokine gene transcription, block T cell production of IL-2, and interfere with T cell activation (Xia Guowei, Zhang Yuanfang; Current status of clini...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01N1/02
Inventor 章晓联陈海丹
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com