Plant expression vector for specific expression of resveratrol in fruit
A technology of plant expression vector and resveratrol, applied in the direction of using vector to introduce foreign genetic material, DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of unreported research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0036] A plant expression vector specifically expressing resveratrol in fruit is characterized in that the promoter in the vector is the promoter of banana lectin gene. The target gene in the vector is the grape stilbene synthase gene. The present invention is described in detail below in conjunction with embodiment:
[0037] 1. Materials
[0038] Tomato (Lycopersicon.sp) (pure line TX0014) was provided by the Quality Resources Institute of the Chinese Academy of Tropical Agricultural Sciences.
[0039] 2. Method
[0040] (1) Construction of a plant expression vector linking the lectin gene promoter to the grape stilbene synthase gene
[0041] 1. PCR amplification of stilbene synthase gene
[0042] Two primers were designed based on the published stilbene synthase gene sequence:
[0043] 5’Primer CCGGATCCGCTTCAATTTCATTACGT
[0044] 3’Primer CCGAGCTCCTCCTATTTGATACATTA
[0045] The total DNA of grapes was used as a template for PCR reaction, and 5.0 μl PCR amplification r...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap