Plant expression vector for specific expression of resveratrol in fruit

A technology of plant expression vector and resveratrol, applied in the direction of using vector to introduce foreign genetic material, DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of unreported research

Inactive Publication Date: 2009-05-27
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the stilbene synthase gene has been studied more i...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector for specific expression of resveratrol in fruit
  • Plant expression vector for specific expression of resveratrol in fruit
  • Plant expression vector for specific expression of resveratrol in fruit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] A plant expression vector specifically expressing resveratrol in fruit is characterized in that the promoter in the vector is the promoter of banana lectin gene. The target gene in the vector is the grape stilbene synthase gene. The present invention is described in detail below in conjunction with embodiment:

[0037] 1. Materials

[0038] Tomato (Lycopersicon.sp) (pure line TX0014) was provided by the Quality Resources Institute of the Chinese Academy of Tropical Agricultural Sciences.

[0039] 2. Method

[0040] (1) Construction of a plant expression vector linking the lectin gene promoter to the grape stilbene synthase gene

[0041] 1. PCR amplification of stilbene synthase gene

[0042] Two primers were designed based on the published stilbene synthase gene sequence:

[0043] 5’Primer CCGGATCCGCTTCAATTTCATTACGT

[0044] 3’Primer CCGAGCTCCTCCTATTTGATACATTA

[0045] The total DNA of grapes was used as a template for PCR reaction, and 5.0 μl PCR amplification r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a plant expression vector for specifically expressing resveratrol in fruit. The vector utilizes an agglutinin genetic promoter specifically expressed in banana fruit to replace combination type 35S promoter on a plant expression vector pBI121, and utilizes grape resveratrol synthetic enzyme gene to replace gus gene on the pBI121. By an agricultural bacillus dip method, the vector is subjected to tomato conversion, PCR detection and Southern blot detection to prove that exogenous gene is successfully inserted in tomato genome; and the RT-PCR detection and the Northern blot detection prove that the agglutinin genetic promoter drives the resveratrol synthetic enzyme gene to make specific expression in tomato fruit. The obtaining of the promoter provides useful tools for specifically expressing the resveratrol in fruit, particularly lays a foundation for utilizing the vector to culture new fruit varieties with health care function. Therefore, the promoter has important application values on trans-genetic research in the future.

Description

[technical field] [0001] The invention relates to constructing a plant expression vector by using a banana fruit to specifically express a Banlec gene promoter carrying a grape stilbene synthase gene. [Background technique] [0002] Banana (Musa spp.) belongs to Musa family (Musaceae). All edible bananas are cultivars of the genus Musa, and are important tropical and subtropical fruits. Banana meat is sweet and glutinous, fragrant and delicious, and has high nutritional value. In addition to eating fresh and cooking, it can also be processed into a variety of nutritious products. Banana is an ideal plant for producing recombinant medicinal proteins and peptides or valuable compounds by transgenic methods. Its advantages as a bioreactor mainly include the following aspects: 1. Its growth period is short, ten to twelve 2, banana is the fruit with the largest consumption of fresh fruit, fresh food can guarantee that the medicinal protein expressed by the gene in the fruit wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N15/52
Inventor 金志强徐碧玉刘菊华张建斌贾彩红杨小亮李美英
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap