Oligonucleotides for modulating target rna activity

An oligonucleotide and RNA interference technology, which is applied in the field of oligonucleotides that affect the activity of target RNAs and regulates the activity of target RNAs, and can solve problems such as off-target effects affecting the activity of target RNAs.

Inactive Publication Date: 2010-02-03
米尔克斯治疗有限责任公司
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, introducing microRNAs into cells or modulating the levels of microRNAs will affect the activity of more than one target RNA and thus may lead to undesired off-target effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotides for modulating target rna activity
  • Oligonucleotides for modulating target rna activity
  • Oligonucleotides for modulating target rna activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0350] Blocking microRNA for the treatment of diabetes

[0351] It has been confirmed that mir-375 is a regulator of insulin secretion by pancreatic islets, and recombinant insulin-like growth factor-1 (Myotrophin (Mtpn)) is a target regulated by mir-375 (Poy MN, 2004). In addition, the inhibition of Mtpn by siRNA mimics the effect of miR-375 on glucose-stimulated insulin secretion and exocytosis. Therefore, the authors concluded that miR-375 is a regulator of insulin secretion and can thereby constitute a new pharmacological target for the treatment of diabetes.

[0352] Here, we provide a blocking microRNA that can regulate the expression of Mtpn through mir-375 regulation that inhibits the Mtpn activity in the 3'UTR of Mtpn mRNA.

[0353] The relevant part of the target mRNA is:

[0354] 5′GUGUUUUAAGUUUUGUGUUGCAA AUGGAAUAAACUUGAAU

[0355] The antisense seed sequence is shown in bold. The target region of the target RNA can be identified, for example, by looking for the target RN...

Embodiment 2

[0404] Blocking microRNA for the treatment of herpes simplex virus infection

[0405] It has recently been confirmed that the microRNA encoded by herpes simplex virus-1 can make the virus develop into a latent infection (Gupta A, 2006). It was discovered that the microRNA called mir-LAT regulates TGF-β and SMAD3, thereby affecting the ability of cells to undergo apoptosis. The infected cells are self-destructed by usual methods to prevent the generation of virus progeny. Therefore, it is interesting to be able to block the mir-LAT regulatory activity in the expression of TGF-β and SMAD3.

[0406] The sequence of the target region of TGF-β mRNA is:

[0407] 5′AGGTCCCGCCCCGCCCCGCCCCGCCCCGGCAGGCCCG CC

[0408] The sequence of mir-LAT is:

[0409] 5′ CCCGGCCCGGGGCC

[0410] Therefore, the following complexes can be formed:

[0411] 5′CGCCCCGGCAGGCCCG

[0412] ||||||| ||| |||| |||

[0413] 3′CCGGGGCC---CGGCCCGGCGGU

[0414] A series of blocking microRNAs can be designed according to the ...

Embodiment 3

[0441] Identify oligonucleotides that regulate Mtpn expression

[0442] The following is a non-limiting example of how this method will proceed. In fact, no wet experiment (wetexperiment) was performed.

[0443] The following sequence is part of the estimated target region of Mtpn mRNA:

[0444] 5′UUUGACGCAGUUGGGUUUCUCAUAAGUAUCCUAGUUCAUGUACAUCCGAAUGCUAAAU

[0445] AAUACUGUGUUUUAAGUUUUGUGUUGCAA GGAAUAAACUUGAAUUGUGCUAC

[0446] It involves a series of potential blocking microRNAs with 50% overlap for this region. Potential blocking microRNAs are shown in italics, and the reference sequence and complementary strand of Mtpn mRNA are shown for comparison:

[0447] 5′UUUGACGCAGUUGGGUUUCUCAUAAGUAUCCUAGUUCAUGUACAUCCGAAUGCUAAAUAAU-

[0448] ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||

[0449] 3′AAACUGCGUCAACCCAAAGAGUAUUCAUAGGAUCAAGUACAUGUAGGCUUACGAUUUAUUA-

[0450]

[0451]

[0452]

[0453]

[0454]

[0455] -

[0456] 5′-ACUGUGUUUUAAGUUUUGUGUUGCAA UGGAAUAAACUUGAAUUGUGCUAC

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention describes oligonucleotides that bind to microRNA target sites in target RNAs, such as mRNAs. The oligonucleotides of the invention may mediate RNase H degradation of the target RNA, mediate RNAi of the target RNA or prevent microRNA regulation of the target RNA. The oligonucleotides of the invention are useful e.g. as research tools for studying microRNA:mRNA interactions andfor therapeutic development. The present invention also describes methods of identifying microRNA target sites, methods of validating microRNA target sites, methods of identifying oligonucleotides ofthe invention and methods of modulating the activity of a target RNA using the oligonucleotides of the invention.

Description

Background technique [0001] The present invention relates to oligonucleotides that can be used to influence the activity of target RNA. [0002] The first-generation oligonucleotides are antisense oligonucleotides used to affect the activity of target mRNA. One of the reasons for the interest of such oligonucleotides is the potential for sensitive and predictable specificity due to specific base pairing. In other words, designing oligonucleotides that are highly specific to a given nucleic acid (such as mRNA) is theoretically very simple. [0003] However, it turned out that not all sequences can be used for antisense targeting, and the accessibility may vary depending on, for example, secondary structure or protein binding reasons. [0004] In addition, it has been found that simple base pairing is not sufficient to achieve the regulation of a given target mRNA, that is, oligonucleotides complementary to a given target mRNA will not necessarily affect the activity of the target mRN...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/113
Inventor索尔莱夫·默勒
Owner米尔克斯治疗有限责任公司