Method for preparing fusion protein capable of lowering food allergen reaction
A fusion protein, food allergy technology, applied in chemical instruments and methods, hybrid peptides, introduction of foreign genetic material using a carrier, etc., can solve problems such as inconvenience in practical operation, and achieve the effect of reducing allergic reactions and easy application in the food industry.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] A method for preparing a fusion protein that reduces food allergen reactions according to the present invention comprises the following steps in sequence:
[0025] 1. Cloning of AnTrx gene
[0026] (1) Find the sequence number (CAK43619) related to Aspergillus niger-like thioredoxin in the genome of Aspergillus niger (A. niger) from NCBI.
[0027] (2) Extraction of total DNA of the strain: Inoculate the spore suspension of Aspergillus niger 3.4523 strain on a potato medium PDA plate, culture at 25°C for 3 days, and extract the total DNA by grinding with liquid nitrogen.
[0028] (3) Design a pair of primers to obtain the AnTrx sequence containing introns from the genome of Aspergillus niger.
[0029] Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the first sequence in the sequence listing)
[0030] Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the second sequence in the sequence listing)
[0031] Using the Aspergillus niger genome as a template, the fragment (456bp) of A...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
