Method for preparing fusion protein capable of lowering food allergen reaction

A fusion protein, food allergy technology, applied in chemical instruments and methods, hybrid peptides, introduction of foreign genetic material using a carrier, etc., can solve problems such as inconvenience in practical operation, and achieve the effect of reducing allergic reactions and easy application in the food industry.

Inactive Publication Date: 2010-12-01
ZHEJIANG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this kind of protein system has not been put into application as a food additive in the food industry. At the same time, the thioredoxin system contains two kinds of proteins, which is inconvenient in actual operation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing fusion protein capable of lowering food allergen reaction
  • Method for preparing fusion protein capable of lowering food allergen reaction
  • Method for preparing fusion protein capable of lowering food allergen reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] A method for preparing a fusion protein that reduces food allergen reactions according to the present invention comprises the following steps in sequence:

[0025] 1. Cloning of AnTrx gene

[0026] (1) Find the sequence number (CAK43619) related to Aspergillus niger-like thioredoxin in the genome of Aspergillus niger (A. niger) from NCBI.

[0027] (2) Extraction of total DNA of the strain: Inoculate the spore suspension of Aspergillus niger 3.4523 strain on a potato medium PDA plate, culture at 25°C for 3 days, and extract the total DNA by grinding with liquid nitrogen.

[0028] (3) Design a pair of primers to obtain the AnTrx sequence containing introns from the genome of Aspergillus niger.

[0029] Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the first sequence in the sequence listing)

[0030] Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the second sequence in the sequence listing)

[0031] Using the Aspergillus niger genome as a template, the fragment (456bp) of A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing fusion protein capable of lowering food allergen reaction, comprising the following steps: obtaining a thioredoxin gene Trx and a thioredoxin reductase gene TrxR in a thioredoxin system; designing a fusion peptide sequence; fusing the genes Trx and TrxR by the fusion peptide sequence; then, obtaining a recombination strain containing the fusion gene; and finally, carrying out heterology expression purification. The invention colons the genes of two proteins in an AnTrx system with wide application meaning in the industry and fuses and improves thegenes of Trx and TrxR, and a disulfide bond in the food protein is reduced by incubating with the food protein so as to lower the allergen reaction thereof. Meanwhile, improvement by gene fusion causes An-TrxR and An-Trx to be convenient to apply in the food industry when An-TrxR and An-Trx serve as a food additive.

Description

technical field [0001] The invention belongs to the field of biotechnology, relates to DNA recombination technology and its application in the field of bioengineering technology, in particular to a method for reducing food allergy by using genetic engineering technology to obtain corresponding biological proteins. Background technique [0002] Allergies are a common problem throughout the world, and food allergies are a type of allergic disease and a cause of severe allergic disease. Epidemiological studies have shown that about 33% of allergic reactions are induced by food. Food allergy has become an important food safety issue and has attracted widespread attention. According to epidemiological surveys, about 2% to 2.5% of people (6 million to 7 million) in the United States have experienced food allergy, and the incidence rate is about 4% to 6% in infants and about 1% to 2% in children and adults. In the UK, the incidence of food allergy is 1.4% to 1.9% in adults and 5% ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C12N15/63C07K19/00
Inventor王晓慧应盛华冯明光
OwnerZHEJIANG UNIV