Method for preparing fusion protein capable of lowering food allergen reaction
A fusion protein and food allergy technology, which is applied in chemical instruments and methods, hybrid peptides, and the use of carriers to introduce foreign genetic materials, etc., can solve the problems of practical operation inconvenience, achieve the effect of reducing allergen reactions and easy application in the food industry
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] A method for preparing a fusion protein that reduces food allergen reactions according to the present invention comprises the following steps in sequence:
[0025] 1. Cloning of AnTrx gene
[0026] (1) Find the sequence number (CAK43619) related to Aspergillus niger-like thioredoxin in the genome of Aspergillus niger (A. niger) from NCBI.
[0027] (2) Extraction of total DNA of the strain: Inoculate the spore suspension of Aspergillus niger 3.4523 strain on a potato medium PDA plate, culture at 25°C for 3 days, and extract the total DNA by grinding with liquid nitrogen.
[0028] (3) Design a pair of primers to obtain the AnTrx sequence containing introns from the genome of Aspergillus niger.
[0029] Forward primer: AACACCCATATGTCTCACAAGGTTCACG (the first sequence in the sequence listing)
[0030] Reverse primer: TGGAAGCTTTGCAAGCAGAGCCTGG (the second sequence in the sequence listing)
[0031] Using the Aspergillus niger genome as a template, the fragment (456bp) of A...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap