Swine promoter protein expression vector and construction method and application thereof
A protein expression and promoter technology, applied in the direction of using a vector to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, high cost, low connection efficiency, etc., and achieve ideal efficiency, improved level, and simple process. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1, the construction of pSP-Vector
[0031] 1) Construction of pS1
[0032] Design primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream, the sequences of primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream are as follows:
[0033] Upstream of pS1 Vector1: 5′ ACATGTTCTTTCCTGCGCCGCTACAGGG 3′;
[0034] Downstream of pS1 Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.
[0035] Upstream of pS1 Vector2: 5′CTCGAGGATATCTGCA GATATC CAGCACAC 3′ (the underlined part is
[0036] EcoR V enzyme recognition site);
[0037] Downstream of pS1 Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.
[0038] Using the pEGFP-N1 (purchased from Invitrogen) plasmid as a template, use primers pS1 Vector1 upstream and pS1 Vector1 downstream PCR amplification fragment A, use pCDNA3.0 plasmid (purchased from Invitrogen) as a template, use primers pS1 Vector2 upstream and pS1 Vector2 Dow...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com