Unlock instant, AI-driven research and patent intelligence for your innovation.

Swine promoter protein expression vector and construction method and application thereof

A protein expression and promoter technology, applied in the direction of using a vector to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, high cost, low connection efficiency, etc., and achieve ideal efficiency, improved level, and simple process. Effect

Inactive Publication Date: 2011-01-19
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

People have been trying for better ways to make viruses that infect animal tissues more effective at producing therapeutic agents or vaccines against diseases caused by virus strain(s). However, current methods require complicated processes like cloning and transformation from yeast to mammals, making it difficult to create multiple types of immunogenic compositions simultaneously without introducing new ones during production.

Problems solved by technology

People have long sought ways for better genetic engineering techniques that could lead to more efficient growth of crops like chickens (chicken). However, current approaches require expensive equipment and complicated procedures involving multiple steps, making them slow down during constructional processes. Therefore there remains room for improvement over existing technologies without compromising their effectiveness at producing desired traits from these plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine promoter protein expression vector and construction method and application thereof
  • Swine promoter protein expression vector and construction method and application thereof
  • Swine promoter protein expression vector and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, the construction of pSP-Vector

[0031] 1) Construction of pS1

[0032] Design primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream, the sequences of primers pS1 Vector1 upstream and pS1 Vector1 downstream, pS1 Vector2 upstream and pS1 Vector2 downstream are as follows:

[0033] Upstream of pS1 Vector1: 5′ ACATGTTCTTTCCTGCGCCGCTACAGGG 3′;

[0034] Downstream of pS1 Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3'.

[0035] Upstream of pS1 Vector2: 5′CTCGAGGATATCTGCA GATATC CAGCACAC 3′ (the underlined part is

[0036] EcoR V enzyme recognition site);

[0037] Downstream of pS1 Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT 3'.

[0038] Using the pEGFP-N1 (purchased from Invitrogen) plasmid as a template, use primers pS1 Vector1 upstream and pS1 Vector1 downstream PCR amplification fragment A, use pCDNA3.0 plasmid (purchased from Invitrogen) as a template, use primers pS1 Vector2 upstream and pS1 Vector2 Dow...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a swine promoter protein expression vector and a construction method and application thereof. The expression vector is annular and comprises a pronucleus replication origin, an eukaryon replication origin, a selection marker gene and an exogenous gene expression cassette, wherein the exogenous gene expression cassette consists of a transcription promoter, a junction fragment and a polyadenylic acid tailing signal sequentially from upstream to downstream; and the transcription promoter is an MLP6 promoter. The expression vector can efficiently express exogenous proteinsin a swine cell, contains the eukaryon replication origin and can be proliferated greatly in a cell of an expression T antigen, so that protein expression level is raised. A recombinant vector of an expression exogenous gene is constructed by homologous recombination, so that the conventional steps such as enzyme cutting, linking and the like are avoided and 2 to 3 steps are saved compared with the conventional linking process. A vector recombination process for constructing the expression exogenous gene by using the vector of the invention is simple, convenient, rapid, economical and efficient and the construction of the expression vectors of a large number of exogenous genes can be finished rapidly.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More