Method for detecting single nucleotide polymorphism of cattle TAS1R3 gene

A single nucleotide polymorphism, gene technology, applied in the field of molecular genetics

Inactive Publication Date: 2011-02-02
XUZHOU NORMAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research on the genetic variation of animal TAS1R3 gene in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting single nucleotide polymorphism of cattle TAS1R3 gene
  • Method for detecting single nucleotide polymorphism of cattle TAS1R3 gene
  • Method for detecting single nucleotide polymorphism of cattle TAS1R3 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention utilizes the PCR-RFLP method to detect the single nucleotide polymorphisms of the synonymous codon mutation at the 2663rd site of the cattle TAS1R3 gene that may cause changes in post-transcriptional splicing efficiency, translation speed and efficiency, and the following is combined with the present invention. The further detailed description is an explanation of the present invention rather than a limitation.

[0025] a. Design of PCR primers for the region containing the ninth exon of cattle TAS1R3 gene

[0026] Taking the bovine (NC_007314.3) sequence published by NCBI as a reference, Primer 5.0 was used to design PCR primers capable of amplifying the sixth exon region of the cattle TAS1R3 gene. The primer sequences are as follows:

[0027] Upstream primer: 5GCCTGGCTGGTAGTGCTGCT20;

[0028] Downstream primer: 5CCAGGAAGGTGCCCAGGAAG20;

[0029] Using the above primers to amplify the cattle genome, it is possible to amplify a 211bp gene fragment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting single nucleotide polymorphism (SNP) of a cattle TAS1R3 gene. The method comprises the following steps of: performing PCR amplification on the cattle TAS1R3 gene by taking TAS1R3 gene-containing cattle whole genome DNA to be detected as a template and a primer pair P as a primer; after a PCR amplification product is digested by restriction endonuclease HindIII, performing polyacrylamide gel electrophoresis on amplified fragments after enzyme cutting; and identifying the SNP of a 2663rd cattle TAS1R3 gene according to a result of the polyacrylamide gel electrophoresis. As the TAS1R3 gene function relates to birth weight, daily gain and weight growth traits, the detection method provided by the invention provides the foundation for establishing a relation between the SNP of the TAS1R3 gene and growth traits, and contributes to marker assistant selection (MAS) of the growth traits of Chinese beef cattle and quick establishment of cattle population with excellent genetic resources.

Description

technical field [0001] The invention belongs to the field of molecular genetics and relates to the detection of gene single nucleotide polymorphism (SNP), in particular to a method for detecting the 2663rd single nucleotide polymorphism of cattle TAS1R3 gene. Background technique [0002] Single nucleotide polymorphism (SNP) refers to the polymorphism caused by the substitution of a single nucleotide (A / T / C / G) in the genomic DNA sequence. Therefore, commonly referred to as SNPs include base substitutions, insertions, deletions, and changes in the copy number of repeated sequences. A SNP indicates that there is a nucleotide change at a certain position in the genome, which is mainly caused by the conversion or transversion of a single base; SNPs with conversion mutations account for about 2 / 3, and other SNPs are in similar level. The cytosine of the CpG dinucleotide is the most mutated site in the genome, most of which are methylated and can be spontaneously deaminated to f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor陈宏袁静张春雷房兴堂汪琴钱丽娜
OwnerXUZHOU NORMAL UNIVERSITY