Method for detecting cattle Vaspin gene single nucleotide polymorphism and application of method
A single nucleotide polymorphism, scalper technology, applied in the field of molecular genetics
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] The present invention uses the PCR-RFLP method to detect the single nucleotide polymorphism that may result in a change in the composition of the encoded protein due to the mutation of the synonymous codon at site 1124477 of the cattle Vaspin gene. The present invention will be further described in detail in conjunction with the following. They are presented by way of explanation, not limitation, of the invention.
[0031] a, the design of PCR primers in the second exon region of the cattle Vaspin gene
[0032] Taking the bovine (NW_001494061) sequence published by NCBI as a reference, Primer5.0 was used to design PCR primers capable of amplifying the region of the ninth exon of the cattle Vaspin gene. The primer sequences are as follows:
[0033] Upstream primer: TGTTATTGTCAGGGCTGCT19;
[0034] Downstream primer: GGCTTAGAGTATGTTGGCAT20.
[0035] Using the above primers to amplify the cattle genome, a 463bp gene fragment containing the second exon region of the cattle V...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
