Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product

A technology that integrates expression and marine animals, applied in the biological field

Active Publication Date: 2012-07-04
XIAMEN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no research report on the tandem expression of these two types of antimicrobial peptides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product
  • Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product
  • Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1 Construction of recombinant expression plasmid pET28a / scygonadin2-hepcidin

[0068] 1) Acquisition of scygonadin2 in Scylla serrata and hepcidin in large yellow croaker:

[0069] According to the multiple cloning sites on the pET28a vector, the scygonadin2 antimicrobial peptide gene of Scylla serrata was designed and synthesized (Genbank accession number: DQ872630 ) and large yellow croaker hepcidin antimicrobial peptide gene (Genbank accession number: EF156401 ) specific upstream and downstream primers. Add an NcoI restriction site to the 5′ end of the upstream primer of the Scylla serrata scygonadin2 gene, and the upstream primer F1 is:

[0070] F1: 5′CAC CCATGG CGAATGGCCTGGCACTCAACAGGCTTATG 3′

[0071] Wherein the black italics indicate the introduced NcoI restriction site.

[0072] Mutate the XhoI restriction site at the 5′ end of the downstream primer of the scygonadin2 antimicrobial peptide gene of Scylla serrata, add a connecting peptide gene se...

Embodiment 2

[0136] Example 2 Induced expression of pET28a / scygonadin2-hepcidin recombinant plasmid in Escherichia coli

[0137]1) Induced expression: Extract the correct identified pET28a / scygonadin2-hepcidin recombinant plasmid by alkaline lysis method, and transform pET28a empty plasmid and pET28a / scygonadin2-hepcidin recombinant plasmid into E.coli BL21(DE3) competent cells by heat shock method in LB solid medium plate containing kanamycin (50 μg / ml), cultured overnight at 37°C; the next day, pick out several pET28a empty plasmids and pET28a / scygonadin2-hepcidin recombinant plasmids to transform expression strains and grow Single colonies were inoculated in 20ml LB liquid medium (containing 50μg / ml kanamycin), shaken at 200rpm, 37°C until OD 600 About 0.3 (OD 600 is the absorbance value of the bacterial culture solution at 600nm), then IPTG was added to a final concentration of 0.6mmol / L, and cultured with shaking at 180rpm at 28°C for 5h.

[0138] 2) Detection of fusion protein expr...

Embodiment 3

[0139] Example 3 Solubility analysis of expression products of pET28a / scygonadin2-hepcidin recombinant plasmid in Escherichia coli

[0140] 1) Transform and culture 20ml of seed solution as above, take 2ml of seed solution and add it to 200ml of LB liquid medium containing 50μg / ml kanamycin, and culture on a shaker at 200rpm at 37°C for 1.5-2h to OD 600 About 0.3, add IPTG to a concentration of 0.6mmol / L, and induce at 28°C for 5h on a shaker at 180rpm.

[0141] 2) Collect the cells by centrifugation, suspend the cells in 20 ml of pre-cooled PBS (pH7.4), freeze and thaw once at -20°C, and disrupt the cells of the cells by ultrasonic in an ice bath.

[0142] 3) Centrifuge the above-mentioned sonicated liquid at 4°C, 12000g, for 15min. The supernatant and the precipitate were collected respectively, and SDS-PAGE electrophoresis was carried out as described above to confirm that the target protein was expressed in the form of inclusion bodies (see Figure 4 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a fusion expression product of antimicrobial peptide genes of two marine animals and a preparation method of the fusion expression product, relating to fish and crab gene engineering in the biotechnical field. The gene of the fusion expression product comprises a scylla serrata antimicrobial peptide scygonadin2 gene, and connection peptide and large yellow croaker antimicrobial peptide hepcidin genes. The preparation method comprises the following steps of: cloning the fusion gene scygonadin2-hepcidin; expressing the fusion gene scygonadin2-hepcidin; and obtaining the fusion expression product of the antimicrobial peptide genes of the two marine animals. In the preparation method, a pET28a prokaryotic expression vector is utilized to successfully and efficiently express the fusion expression product, which has antibiosis activity, of the scylla serrata antimicrobial peptide scygonadin2 and the large yellow croaker antimicrobial peptide hepcidin is expressed, so that the officinal value of tandem antimicrobial peptides can be developed.

Description

technical field [0001] The invention relates to the genetic engineering of fish and crabs in the field of biotechnology, in particular to a fusion expression product of scygonadin2, an antibacterial peptide of Scylla serrata, and hepcidin, an antibacterial peptide of large yellow croaker, and a preparation method thereof. Background technique [0002] With the maturity of molecular biology technology and its wide application in biology and medicine, the genes of antimicrobial peptides in aquatic animals have been discovered and studied one after another, (1, Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria[J ].Nat.Rev.Microbiol.2005,3:238-250; 2. S.E.Lofgren, L.C.Miletti, M.Steindel, E.Bachere, M.A.Barracco.Trypanocidal and leishmanicidal activities of different antimicrobial peptides (AMPs) isolated from aquatic animals .[J].Experimental Parasitology.2008, 118:197-202) This makes the development of corresponding antimicrobial peptide drug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C07K19/00C12N15/12C12N15/70
Inventor 王克坚黄晟沛蔡晶晶
Owner XIAMEN UNIV