Unlock instant, AI-driven research and patent intelligence for your innovation.

Indiscriminate amplification method of double-strand cDNA and genomic DNA

A non-differential, base-based technology, applied in the field of non-differential amplification of double-stranded cDNA and genomic DNA

Inactive Publication Date: 2012-05-16
HANGZHOU NORMAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the genome equivalent amplification of rare samples has similar problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indiscriminate amplification method of double-strand cDNA and genomic DNA
  • Indiscriminate amplification method of double-strand cDNA and genomic DNA
  • Indiscriminate amplification method of double-strand cDNA and genomic DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Expansion of mouse spinal cord double-stranded cDNA

[0036] Proceed as follows:

[0037] 1. First strand cDNA synthesis

[0038] 1. Add on ice

[0039] 5μl Total RNA (about 2μg)

[0040] 4μl 5×RT buffer (Takara)

[0041] 1 μl 10mM dNTPs (Takara)

[0042] 0.5μl I-SceIdT (50M, as OligodT primer)

[0043] 0.5μl RNase Inhibitor (40u / μl) (NEB)

[0044] 1 μl PrimeScript II (200u / μl) (Takara)

[0045] 8 μl DEPC-treated HO 2 o

[0046] The total volume is 20 μl;

[0047] The I-SceIdT sequence is as follows: GACGC TAGGGATAACAGGGTAAT TTTTTTTTTTTTTTTVN, the underlined part is the recognition site of endonuclease I-SceI;

[0048]2. Mix gently and centrifuge briefly, incubate at 42°C for 1 hour, then at 45°C for 30 minutes, then at 50°C for 10 minutes.

[0049] 2. Synthesis of double-stranded cDNA

[0050] 1. Add 20 μl of the first-strand cDNA synthesis reaction product to the following system (operated on ice):

[0051] 8μl 10×RNase H buffer (NEB)

[005...

Embodiment 2

[0087] Example 2: Amplification of a target fragment with normal GC content using the amplified mouse spinal cord double-stranded cDNA:

[0088] Primers were designed according to the sequence of the target gene Gpr178 in Genbank to amplify a 583bp fragment with a GC content of 53.69%.

[0089] The primer sequences are as follows:

[0090] Forward primer: TGCTTGGCTTCCCTGGTGGCTC

[0091] Reverse primer: ATGGGCTGGTTCAGGTGC

[0092] The composition of the PCR reaction system is as follows:

[0093] 17.25 μl H 2 o

[0094] 2.5μl 10×Taq Buffer (Fermentas)

[0095] 1.5 μl MgCl2 (25 mM, Fermentas)

[0096] 0.5μl dNTPs (10mM, NEB)

[0097] 1 μl forward primer (10 μM)

[0098] 1 μl reverse primer (10 μM)

[0099] 1 μl template cDNA

[0100] 0.25μl Taq DNA Polymerase (Fermentas)

[0101] Total volume 25 μl per tube.

[0102] The PCR conditions are as follows:

[0103] Pre-denaturation at 94°C for 4 minutes

[0104]

[0105] 72℃10min

[0106] Amplified products such as ...

Embodiment 3

[0107] Example 3: Using the amplified mouse spinal cord double-stranded cDNA to amplify genes with high GC content:

[0108] The target gene is Wnt10B, the GC content of its open reading frame (ORF) region is as high as 62.22%, the length is 1170bp, and the ORF region of Wnt10B is amplified.

[0109] The primer sequences are as follows:

[0110] Forward primer: ATGCTGGAGGAGCCCCGG

[0111] Reverse primer: TCATTTACACACATTGAC

[0112] The composition of the PCR reaction system is as follows:

[0113] 17.25 μl H 2 o

[0114] 2.5μl 10×Taq Buffer (Fermentas)

[0115] 1.5 μl MgCl2 (25 mM, Fermentas)

[0116] 0.5μl dNTPs (10mM, NEB)

[0117] 1 μl forward primer (10 μM)

[0118] 1 μl reverse primer (10 μM)

[0119] 1 μl template cDNA

[0120] 0.25μl Taq DNA Polymerase (Fermentas)

[0121] Total volume 25μl per tube

[0122] The PCR conditions are as follows:

[0123] Pre-denaturation at 94°C for 4 minutes

[0124]

[0125] 72℃10min

[0126] Amplified products such as ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an indiscriminate amplification method of double-strand cDNA and genomic DNA, which comprises the steps of: constructing an OligodT primer I-SceId containing a rare restriction enzyme I-SceI recognition site, reversely transcribing a sample RNA by utilizing the primer to synthesize a first-strand cDNA, adding an RNAseH enzyme and a DNA Polymerase I enzyme into the first-strand cDNA to synthesize a double-strand cDNA, then floating the tail end of the double-strand cDNA (amplifying the genomic DNA from the step), adding a basic group A at the 3' tail end of the double-strand cDNA (or the genomic DNA), and finally adding connectors Zip T at two ends of the double strands so that the double-strand DNA is modified into a single-strand ring structure and subjected to rolling circle amplification under the action of a phi29DNA polymerase to produce a large amount of double-strand cDNAs or genomic DNAs. The indiscriminate amplification method of double-strand cDNA and genomic DNA can be used for amplifying various cDNAs and genomic DNAs efficiently and indiscriminately, has the functions of amplifying and storing genomic DNAs and cDNAs of rare samples, and can also be used for efficiently increasing the content of GC (Guanylate Cyclase) and amplifying DNAs with complicated secondary-structures.

Description

(1) Technical field [0001] The invention relates to a method for indiscriminately amplifying double-strand cDNA and genome DNA. (2) Background technology [0002] When the sample is relatively small, rare and precious, it is often necessary to perform reverse transcription and amplification of its RNA before obtaining enough cDNA for experiments such as construction of cDNA library, gene cloning and expression analysis. At present, there are three main amplification methods: ①Add the promoter sequence of RNA polymerase such as T7, T3 or SP6 in the process of reverse transcription, synthesize double-stranded cDNA, and then use these RNA polymerases to transcribe RNA, and then make it amplified ; ② During reverse transcription, other adapter sequences were added, and then the cDNA was amplified by PCR using primers matching the adapter sequence; ③ After reverse transcription, the single-stranded cDNA was ligated into a circle with Circligase (Epicentre Biotechnologies), and th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12Q1/68
Inventor 朱晓静赵盼戴忠敏张遵义
Owner HANGZHOU NORMAL UNIVERSITY