Glutamate decarboxylase gene and use thereof

A glutamic acid decarboxylase and gene technology, applied in the field of genetic engineering, can solve the problems of high production cost and complicated GABA process, and achieve the effect of reducing production cost

Active Publication Date: 2012-10-10
JIANGNAN UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the process of producing GABA in the prio

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Acquisition of the glutamic acid decarboxylase gene gadB2

[0018] A γ-aminobutyric acid-producing lactic acid bacterium was screened out from the series of lactic acid bacteria in our laboratory by paper chromatography. Through microscopic examination and 16SrDNA identification, it was confirmed that the homology with the 16SrDNA of various Lactobacillus brevis published in GenBank was 99%, thus confirming that the bacterial strain is Lactobacillus brevis.

[0019] The Lactobacillus brevis has been preserved in the China Type Culture Collection Center on December 27, 2010, address: Wuhan, China, Wuhan University, preservation number: CCTCC NO: M 2010367, taxonomic designation: Lactobacillus brevis Lb85 ( Lactobacillus brevis Lb85).

[0020] Primers were designed based on the glutamic acid decarboxylase gene LVIS_0079 of Lactobacillus breve ATCC 367, which has been published in the complete genome sequence, and the genome of the screened GABA-producing Lact...

Embodiment 2

[0025] Example 2: Construction of recombinant Corynebacterium glutamicum pDXW8-gadB2 / ATCC13032:

[0026] 1. Digest gadB2 and pDXW-8 with the same two restriction enzymes NheI and HindIII to recover 1.46kb and 9.48kb fragments respectively, and then connect the two fragments with T4 DNA ligase, And transformed into Escherichia coli JM109 to complete the construction of pDXW8-gadB2 recombinant plasmid;

[0027] 2. The recombinant plasmid pDXW8-gadB2 was introduced into the competent Corynebacterium glutamicum ATCC13032 by electrotransformation to obtain the recombinant Corynebacterium glutamicum pDXW8-gadB2 / ATCC13032.

[0028] Competent preparation of Corynebacterium glutamicum ATCC13032. Cultivate a single colony of Corynebacterium glutamicum ATCC13032 in liquid LBG medium (10g / L peptone, 5g / L yeast powder, 10g / L NaCl, 5g / L glucose) at 30°C overnight, and then transfer to Inoculated in 30mL competent medium (10g / L peptone, 5g / L yeast powder, 10g / L NaCl, 25g / L glycine, 0.1...

Embodiment 3

[0029] Example 3: Acquisition of the glutamic acid decarboxylase gene gadCB2

[0030] Primers were designed based on the gadC-gadB2 gene LVIS_0078-LVIS_0079 of Lactobacillus brevis ATCC 367, which has been published in the complete genome sequence, and the genome of the screened GABA-producing Lactobacillus brevis CCTCC NO: M 2010367 was used as a template, using PCR technology The gene gadCB2 encoding glutamic acid decarboxylase in its genome was amplified and sequenced, and its nucleotide sequence was shown as Seq ID NO.2.

[0031] Upstream primer CB2F:

[0032] 5’-CTACTCGAGAGAAGGAGATATACC ATGGATGAAAATAAGTCTGAACAGC-3'

[0033] Downstream primer B2R:

[0034] 5'-GATAAGCTT TTAACTTCGAACGGTGGTCTTG -3'

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a glutamate decarboxylase gene and use thereof and belongs to the technical field of genetic engineering. In the invention, a glutamate decarboxylase gene gadB2 derived from Lactobacillus brevis, and a transportprotein gene gadC and a regulatory protein gene gadR, which are connected with the gadB2, are transferred into Corynebacterium glutamicum ATCC13032 through a corynebacterium expression vector pDXW8, and the recombinant Corynebacterium glutamicum can directly convert self accumulated glutamic acid into gamma-aminobutyric acid.

Description

technical field [0001] The invention relates to a glutamic acid decarboxylase gene and its application, belonging to the technical field of genetic engineering. Background technique [0002] γ-Aminobutyric acid (GABA for short) is produced by decarboxylation of glutamic acid (Glu) catalyzed by glutamate decarboxylase (GAD for short). γ-aminobutyric acid is an important inhibitory neurotransmitter in the mammalian central nervous system. It has important physiological functions. The reported physiological activities include regulating blood pressure, promoting mental stability, promoting brain blood flow, enhancing brain vitality, nourishing nerve cells, increasing growth hormone secretion, strengthening liver and kidney, preventing obesity, and promoting alcohol metabolism ( Sober up), improve menopausal syndrome and other effects. [0003] At present, there have been related reports on the research on further increasing the production of GABA by overexpressing the glutami...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/60C12N1/21C12R1/15
Inventor 史锋李佑新李永富李烨
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap