Primer and probe sequence for detecting porcine Hokovirus nucleotide fragment
A probe sequence and nucleotide technology, which is applied in the field of primers and probe sequences for detecting porcine Hokovirus nucleotides, can solve problems such as onset, and achieve the effects of saving manpower and material resources, good specificity, and avoiding false negative results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] 1. Design of primers and probes: Through comparative analysis of the porcine Hokovirus genome sequence, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally about 20-30 bases. There is no complementary sequence between primers and within primers. The optimal primer and probe sequence combinations are as follows:
[0034] Upstream primer HoVTF: GCCTTTTCGGCGTTTAACC
[0035] Downstream primer HoVTR: CGCGACGGAGGAATGG
[0036] Probe HoVTM: CCCAAAATCAAAGTCTGTACGCCCGGC
[0037] 2. Establishment and optimization of the reaction system: using the tissue samples of pig Hokovirus-infected pigs as samples to be tested, virus genomic DNA was extracted by conventional methods, and stored at -20°C for later use.
[0038] 2.1 Optimization of primer concentration: under the same conditions in the reaction system, the primer concentration of porcine Hokovirus was serially...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 