Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and probe sequence for detecting porcine Hokovirus nucleotide fragment

A probe sequence and nucleotide technology, which is applied in the field of primers and probe sequences for detecting porcine Hokovirus nucleotides, can solve problems such as onset, and achieve the effects of saving manpower and material resources, good specificity, and avoiding false negative results

Inactive Publication Date: 2013-07-17
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is speculated that porcine Hokovirus virus may infect most of the tissues of pigs, and since there is no difference in the infection rate of porcine Hokovirus in healthy pigs and diseased pigs, whether the virus can cause disease needs further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for detecting porcine Hokovirus nucleotide fragment
  • Primer and probe sequence for detecting porcine Hokovirus nucleotide fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] 1. Design of primers and probes: Through comparative analysis of the porcine Hokovirus genome sequence, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally about 20-30 bases. There is no complementary sequence between primers and within primers. The optimal primer and probe sequence combinations are as follows:

[0034] Upstream primer HoVTF: GCCTTTTCGGCGTTTAACC

[0035] Downstream primer HoVTR: CGCGACGGAGGAATGG

[0036] Probe HoVTM: CCCAAAATCAAAGTCTGTACGCCCGGC

[0037] 2. Establishment and optimization of the reaction system: using the tissue samples of pig Hokovirus-infected pigs as samples to be tested, virus genomic DNA was extracted by conventional methods, and stored at -20°C for later use.

[0038] 2.1 Optimization of primer concentration: under the same conditions in the reaction system, the primer concentration of porcine Hokovirus was serially...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer and probe sequence for detecting a porcine Hokovirus nucleotide fragment, belonging to the technical field of animal pathogenic microorganism detection. The primer comprises a primer pair consisting of an upstream primer HoVTF with a sequence GCCTTTTCGGCGTTTAACC and a downstream primer HoVTR with a sequence CGCGACGGAGGAATGG; and the probe HoVTM has a sequence CCAAATCAAAGTCTGTACGCCCGGC. The sequences of the primer and probe are designed according to the genome sequence (GQ869539-GQ869543) of the porcine Hokovirus on GenBank, and have relatively high sensitivity and specificity.

Description

Technical field [0001] The invention is the field of animal pathogenic microbial testing technology.Specifically involves a primer and probe sequence for detecting pig HKOVIRUS nucleotides. Background technique [0002] Pig Hokovirus (PHOV) is a newly discovered in 2008 in Hong Kong.The same as the Hokovirus belongs to the Hokovirus subtype, both belong to the small virus (Parvovirinae).The relationship between pig Hokovirus and human type 4 and type 5 virus (Parv4 / 5) is very close. [0003] Although pig Hokovirus is a small virus, it is not yet a report that is not yet ill.The existence of the virus was detected, and the infection rate was very high, up to 44.4%.As a result, it is speculated that pig Hokovirus virus may infect most of the tissue of pigs, and because there is no difference in the infection rate of Hokovirus in healthy pigs and sick pigs, whether the virus will cause further research if the virus will cause the disease.At the same time, researchers found that Porc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 李彬何孔旺毛立温立斌张雪寒倪艳秀
Owner JIANGSU ACAD OF AGRI SCI