Method for improving polymerase chain reaction amplification effect by utilizing uridine
A technology of chain reaction and polymerase, which is applied in the field of polymerase chain reaction amplification, can solve the problems of inconvenient application and large difference in effect, and achieve the effect of improving specificity, obvious effect, and easy-to-master optimization method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0024] 1. Preparation of uridine (Uridine) solution:
[0025] Uridine, also known as Uridine, 1-β-D-Ribofuranosyl uracil, has a molecular formula of C9H12N2O6 and a molecular weight of 244.20. The uridine solid powder can be a commercially available product, which belongs to the prior art and will not be described in detail. The concentration of the uridine solution is as follows: solutions with different concentrations can be prepared according to needs, and the unit of the concentration is mass-volume ratio (W / V), and the range is 40-50 mg / mL. The general recommended concentration is 40mg / mL. Taking the uridine solution with a concentration of (W / V) 40mg / mL as an example, first accurately weigh 40mg of uridine powder, put it in a sterilized 1.5mL small centrifuge tube, and slowly add the sterilized solution with a pipette. water to dissolve, and finally dilute to 1 mL.
[0026] 2. Sterilization of uridine solution: All solutions need to be sterilized at high temperature (...
Embodiment 1
[0040] Synergistic effect of uridine on general PCR (non-high GC):
[0041] 1) Preparation of uridine solution: 40mg / ml;
[0042] 2) Sterilization of uridine solution: high temperature sterilization (121°C, 30min);
[0043] 3) Configuration of PCR reaction system:
[0044] Configure the system in thin-walled PCR tubes in the following order and dosage:
[0045] 10X PCR Buffer 1.2μL
[0046] dNTPs (25mM) 0.1μL
[0047] Template (100ng / ul) 0.2μL
[0048] Primer 1 (2.0μM) 0.75μL
[0049] Primer 2 (2.0μM) 0.75μL
[0050] Mg 2+ (25mM) 1.2μL
[0051] Taq (5U / μL) 0.2μL
[0052] Uridine (40mg / ml) or H 2 O 7.6 μL
[0053]
Primer 1
Primer 2
Amplified length
1
TTTATGGTTGTTGCCCCTCTCCTA
AGAAGAAAAAGCCTGAGCTTGGT
881
[0054]Among them, the template is human Genome DNA, which is extracted by our laboratory. Taq enzyme and PCR buffer were purchased from Beijing Sanbo Yuanzhi Bioengineering Company. Configure 2 tubes of PCR system in...
Embodiment 2
[0063] Synergistic effect of uridine on high GC sequence PCR:
[0064] 1) Preparation of uridine solution: 40mg / ml;
[0065] 2) Sterilization of uridine solution: high temperature sterilization (121°C, 30min);
[0066] 3) Configuration of PCR reaction system:
[0067] Configure the system in a thin-walled PCR tube in the following order and dosage.
[0068] 10X PCR Buffer 1.2μL
[0069] dNTPs (25mM) 0.1μL
[0070] Template (100ng / ul) 0.2μL
[0071] Primer 1 (2.0μM) 0.8μL
[0072] Primer 2 (2.0μM) 0.8μL
[0073] Mg 2+ (25mM) 1.2μL
[0074] Taq (5U / μL) 0.2μL
[0075] Uridine (40mg / ml) or H 2 O 7.5 μL
[0076]
[0077] Among them, the template is human Genome DNA, which is extracted by our laboratory. Taq enzyme and PCR buffer were purchased from Beijing Sanbo Yuanzhi Bioengineering Company. A total of 12 tubes of PCR system were configured, and 6 pairs of primers were used, numbered 1, 2, 3, 4, 5, 6; the numbers of uridine added were 1', 2', 3', 4', 5', 6 '. Th...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap