GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof

A hybridoma cell line and monoclonal antibody technology, applied in the field of cell engineering, can solve the problems of limited protein application and high price, and achieve the effects of easy survival, reduced production cost, and sensitive and easy response.

Active Publication Date: 2012-08-15
GUANGZHOU DARUI BIOTECH
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the antibody products that can detect GPG3 are the products of some foreign companies such as BioMosaics, which are expensive, which limits the application of this protein in clinical target verification and functional research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof
  • GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof
  • GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Preparation of GPC3 recombinant protein

[0025] 1. Construction of GPC3 / PET-11b recombinant vector

[0026] According to the human GPC3 mRNA (NM_001164619) sequence provided in GenBank, the N-terminal signal peptide was removed, and a pair of primers were designed for bases 72-369 of the sequence. The upstream primer: 5' TAATGAATTCATGCAGCCCCCGCCGCC 3' (SEQ ID NO: 1) downstream primer: 5' AGCGGTCGACTCACTTGGCATGGCGAACAACAA 3' (SEQ ID NO: 2). Introduced at the 5' ends of the two primers Eco RI and Sal Ⅰ Restriction site, using the conventional PCR method to use the cDNA reverse-transcribed from the total RNA of Huh7 (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences) as a template to transfer the GPC3 N-terminal gene, and agarose gel electrophoresis showed that the GPC3 N-terminal was successfully obtained gene, the fragment length was as expected ( figure 1 ).

[0027] The prokaryotic expression vector PET-11b (purchased from Mer...

Embodiment 2

[0033] Example 2 Preparation of mouse anti-human GPC3 monoclonal antibody

[0034] 1. Establishment of Hybridoma Cell Lines

[0035] (1) Immunization of mice

[0036] The purified GPC3 recombinant protein was mixed with 250 μL of Bentonite adjuvant, and BALB / c mice were subcutaneously injected into BALB / c mice at 100 μg / 500 μL, and BALB / c mice were injected subcutaneously at 100 μg / 500 μL at intervals of three weeks. c mice, starting from the third immunization, the mouse blood was collected from the tail vein in the second week after each immunization, and prepared for fusion after the serum titer was detected by indirect ELISA method to reach 1:50,000 or more. Three days before the fusion, the tail vein was injected Booster immunization once, antigen dose 100 μg.

[0037] (2) Determination of immune serum titer

[0038] The titer of immune serum was determined by indirect ELISA. Dissolve 30 μg of GPC3 recombinant protein in 10 mL of 0.05 M pH9.6 carbonate buffer, coat ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and a preparation method and application thereof, which belong to the technical field of cell engineering. The preservation code of the GPC3 monoclonal antibody hybridoma strain 8G6 is CGMCC (china general microbiological culture collection center) No.5427. The preparation method of the GPC3 monoclonal antibody hybridoma strain 8G6 includes: using GPC3 protein as immunogen to immunize a mouse; and fusing mouse splenocytes having serum titer more than 1:104 with SP2 / 0 myeloma cells, using an HATRPMI-1640 medium to screen fusion cells, and finally obtaining the hybridoma strain 8G6 by ELISA (enzyme-linked immunosorbent assay) and repeated limiting dilution. The GPC3 monoclonal antibody hybridoma strain 8G6 is high in yield of secretory antibodies, and is easy to survive, and the secreted monoclonal antibodies are high in titer, sensitive in reaction, easy to detect, low in production cost and widely applicable to detection of GPC3 protein expression.

Description

technical field [0001] The invention relates to the technical field of cell engineering, in particular to a GPC3 monoclonal antibody hybridoma cell line 8G6 and a preparation method and application thereof. Background technique [0002] Hepatocellular carcinoma (hepatocellular carcinoma, HCC) is one of the most common malignant tumors in the world, which seriously endangers human life and health. According to reports, among all diseases, the incidence of hepatocellular carcinoma ranks fifth and the mortality rate ranks third three. It is estimated that there are more than 1 million newly discovered HCC patients and about 1 million deaths worldwide every year. Because the early symptoms and signs of HCC are not obvious or lack of specificity, the early diagnosis rate of HCC is low, and patients often seek medical treatment in the middle and late stage, losing the chance of treatment (research shows that early and mid-stage HCC can be treated surgically, and small liver cance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/20C07K16/18C12N15/06G01N33/68G01N33/577
Inventor 马瑞娟徐伟文李明
Owner GUANGZHOU DARUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap