Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cortisol hormone aptamer and application thereof

A cortisol hormone and nucleic acid aptamer technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of different antibody titers, difficulty in antibody preparation, low immunogenicity, etc. problems, to achieve the effect of simple use method, flexible detection method, good repeatability and stability

Active Publication Date: 2014-05-28
INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a small molecular substance, cortisol has low immunogenicity and it is difficult to prepare antibodies
Generally, it is often necessary to couple with protein macromolecules for immunization, and the coupling method is often difficult, and its structural features are often blocked after coupling; in antibody screening, a large number of clones are required to obtain high-specificity and high-affinity antibodies. Among them, it is difficult to establish the method, and there are many interference factors in its detection. At present, the detection technology based on antibodies has inherent limitations, such as: ① different manufacturers, different antibodies, and different batches of different antibody titers; , There are strict conditions when using, such as: temperature, pH value, osmotic pressure restrictions; ③ There are many interference factors in the reaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cortisol hormone aptamer and application thereof
  • Cortisol hormone aptamer and application thereof
  • Cortisol hormone aptamer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Screening of cortisol hormone nucleic acid aptamers

[0024] The initial library is fixed at both ends, with a random sequence of 35 bases in the center, (5'-GCATCACTACAGTCATTACGCATCG(N35)ATCGTGTGAAGTGCTGTCCC-3'), synthesized by a DNA synthesizer, purified by HPLC, dissolved in 100 μl SHMCK buffer, and coupled with primers Magnetic beads (M-P3) were washed 3 times with SHMCK, placed in a 400μl system, added the above library and 10nmol primer P2 (5'-GCATCACTACAGTCATTACGCATCG-3'), mixed the three components for hybridization assembly reaction: 94°C for 1 min , 45°C for 30min, react at room temperature for 6h, and overnight at 4°C. After washing, target cortisol was added to 500 μl of SHMCK system for incubation; Dry the precipitate and dry it with ddH 2 After the O is dissolved, combine and mix well. Use this as a template to perform PCR. In the PCR system, the downstream primer P2 (5'-ATCGTGTGAAGTGCTGTCCC-3') is labeled with biotin at the 5' end for PCR ampl...

Embodiment 2

[0029] Example 2 Colloidal gold aggregation chromogenic method for detecting cortisol hormones

[0030] Detection principle: Cortisol-specific nucleic acid aptamers, as single-stranded DNA, can wrap colloidal gold particles to increase the stability of colloidal gold. When salt is added, colloidal gold does not aggregate; when the target exists, the target cortisol binds to the specific nucleic acid aptamer , the nucleic acid aptamer dissociates from the colloidal gold particles, and the stability of the colloidal gold is weakened. When salt is added, the colloidal gold aggregates, and its maximum absorption wavelength changes, and the color changes from red to purple. The degree of change is proportional to the target concentration. Cortisol concentrations were thus measured (eg figure 1 shown).

[0031] Steps:

[0032] In a 150ul system, 20nM concentration of nucleic acid aptamer (SEQ ID.5) was incubated with targets of different concentrations (0, 10uM, 20uM, 40uM, 80uM, ...

Embodiment 3

[0034] Example 3 Apta-PCR method for detecting cortisol hormones

[0035] Detection principle: such as image 3As shown, the specific nucleic acid aptamer is captured on the magnetic beads, the target is added, the target interacts with the nucleic acid aptamer, causing a conformational change, dissociated from the magnetic beads, and magnetically separated, using the dissociated nucleic acid aptamer as a template, Real-time-PCR detection is performed, the amount of dissociated aptamer is positively correlated with the target concentration, and negatively correlated with the Ct value, so as to achieve the purpose of detection.

[0036] Steps:

[0037] 1mg of immobilized magnetic beads of nucleic acid aptamer complementary sequence, and synthetic SEQ ID.5 1nmol (5'- GCATCACTACAGTCATTACGCATCG GGGGCACGAGGGTATGTTCTATGGGTGGAGGGTGG ATCGTGTGAAGTGCTGTCCC-3' ) Nucleic acid aptamers were annealed and assembled. After washing, target cortisol with different concentrations (0, 0.016,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cortisol hormone aptamer and application thereof, belonging to the technical field of detection of glucocorticoid. The cortisol hormone aptamer comprises a nucleotide sequence shown in SEQ ID No.1 to SEQ ID No.10 in a sequence table and a complementary sequence of the nucleotide sequence as well as sequences obtained by displacing bases of the sequences by methylated purine, dihydrouracil or hypoxanthine. The cortisol hormone aptamer disclosed by the invention is oligonucleotide and has the advantages of smaller molecular weight, higher affinity and specificity than an antibody and favorable repeatability and stability; the cortisol hormone aptamer can be chemically synthesized, so that the cost is saved; the cortisol hormone aptamer is convenient to mark and can form selectively marks at different parts; and the cortisol hormone aptamer is easy to store, i.e., the cortisol hormone aptamer is insensitive to high temperature and extreme conditions.

Description

technical field [0001] The invention belongs to the technical field of glucocorticoid detection, and in particular relates to a cortisol hormone nucleic acid aptamer and application thereof. Background technique [0002] Glucocorticoid (GC) is an important hormone in the human body, which regulates a variety of physiological functions, and its abnormality often leads to the occurrence of various diseases. Glucocorticoids in biological samples are mainly cortisol and corticosterone, and cortisol is the main component. Cortisol The detection methods include thin layer chromatography (TCL), gas chromatography (GC), high performance liquid chromatography (HPLC), gas - mass spectrometry (GC-MS), liquid mass spectrometry (LC-MS), capillary Electrophoresis, etc. Although these methods have high sensitivity and specificity, they require complex purification steps and expensive instruments and equipment, and are not easy to be popularized and used. [0003] The ELISA detection tech...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12Q1/68
Inventor 钱令嘉弓景波张岭
Owner INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com