Cortisol hormone aptamer and application thereof
A cortisol hormone and nucleic acid aptamer technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of different antibody titers, difficulty in antibody preparation, low immunogenicity, etc. problems, to achieve the effect of simple use method, flexible detection method, good repeatability and stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Screening of cortisol hormone nucleic acid aptamers
[0024] The initial library is fixed at both ends, with a random sequence of 35 bases in the center, (5'-GCATCACTACAGTCATTACGCATCG(N35)ATCGTGTGAAGTGCTGTCCC-3'), synthesized by a DNA synthesizer, purified by HPLC, dissolved in 100 μl SHMCK buffer, and coupled with primers Magnetic beads (M-P3) were washed 3 times with SHMCK, placed in a 400μl system, added the above library and 10nmol primer P2 (5'-GCATCACTACAGTCATTACGCATCG-3'), mixed the three components for hybridization assembly reaction: 94°C for 1 min , 45°C for 30min, react at room temperature for 6h, and overnight at 4°C. After washing, target cortisol was added to 500 μl of SHMCK system for incubation; Dry the precipitate and dry it with ddH 2 After the O is dissolved, combine and mix well. Use this as a template to perform PCR. In the PCR system, the downstream primer P2 (5'-ATCGTGTGAAGTGCTGTCCC-3') is labeled with biotin at the 5' end for PCR ampl...
Embodiment 2
[0029] Example 2 Colloidal gold aggregation chromogenic method for detecting cortisol hormones
[0030] Detection principle: Cortisol-specific nucleic acid aptamers, as single-stranded DNA, can wrap colloidal gold particles to increase the stability of colloidal gold. When salt is added, colloidal gold does not aggregate; when the target exists, the target cortisol binds to the specific nucleic acid aptamer , the nucleic acid aptamer dissociates from the colloidal gold particles, and the stability of the colloidal gold is weakened. When salt is added, the colloidal gold aggregates, and its maximum absorption wavelength changes, and the color changes from red to purple. The degree of change is proportional to the target concentration. Cortisol concentrations were thus measured (eg figure 1 shown).
[0031] Steps:
[0032] In a 150ul system, 20nM concentration of nucleic acid aptamer (SEQ ID.5) was incubated with targets of different concentrations (0, 10uM, 20uM, 40uM, 80uM, ...
Embodiment 3
[0034] Example 3 Apta-PCR method for detecting cortisol hormones
[0035] Detection principle: such as image 3As shown, the specific nucleic acid aptamer is captured on the magnetic beads, the target is added, the target interacts with the nucleic acid aptamer, causing a conformational change, dissociated from the magnetic beads, and magnetically separated, using the dissociated nucleic acid aptamer as a template, Real-time-PCR detection is performed, the amount of dissociated aptamer is positively correlated with the target concentration, and negatively correlated with the Ct value, so as to achieve the purpose of detection.
[0036] Steps:
[0037] 1mg of immobilized magnetic beads of nucleic acid aptamer complementary sequence, and synthetic SEQ ID.5 1nmol (5'- GCATCACTACAGTCATTACGCATCG GGGGCACGAGGGTATGTTCTATGGGTGGAGGGTGG ATCGTGTGAAGTGCTGTCCC-3' ) Nucleic acid aptamers were annealed and assembled. After washing, target cortisol with different concentrations (0, 0.016,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
