Kit for detecting high myopia
A technology of high myopia and a kit, which is applied in the measurement/testing of microorganisms, biochemical equipment and methods, etc., can solve the problems of ineffective control of myopia progress, effective treatment of patients, and yet to be verified, and achieve a good market application prospect Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1 Sample collection and extraction of genomic DNA
[0063] The family and case samples are all from the National Natural Science Foundation of China (project number: 30900809, 81170883), the National Outstanding Youth Fund (81025006), and the 973 project undertaken by the Sichuan Provincial Key Laboratory of Human Disease Gene Research, Sichuan Academy of Medical Sciences Sichuan Provincial People's Hospital Samples collected by the sub-project (2011CB504604) and the Sichuan Science and Technology Department project (2010SZ0138). There were 30 members of the high myopia family (951) (20 survived), including 10 highly myopic patients (6 survived); 300 cases of sporadic highly myopic patients, with an average age of 33.6±12.6 years, of which 46.3% were male, and normal controls 600 cases (inclusion criteria: over 40 years old, long-term close work, diopter>-1.0D), mean age 55.8±9.2 years, 47.8% of them were male (Table 1). All subjects were of Han nationality and...
Embodiment 2
[0069] Example 2 Detection of the 2156-position A→G mutation site of the ZNF644 gene
[0070] 1. Detection method
[0071] 1. Extract the blood genome DNA of the surviving members of the high myopia family (951)
[0072] 2. Detection of the A→G mutation site at position 2156 of the ZNF644 gene
[0073] (1) PCR amplification:
[0074] Using the genomic DNA obtained in step 1 as a template and the primer pair A (upstream primer: ACCAGGAGAGAAGACAGAAG; downstream primer: TTTTGAAATGCACAGGATAT) shown in SEQ ID NO.
[0075] System: 2×PCRmix 10μl, upstream and downstream primers (5pm) 1μl each, template DNA (30ng / μl) 1μl, ddH 2 O 7 μl.
[0076] Program: Denaturation at 95°C for 5 minutes; 35 cycles at 95°C for 30 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 1 minute; extension at 72°C for 7 minutes, and incubation at 12°C.
[0077] The amplified product is the sequence (879bp) shown in SEQ ID NO.3-4:
[0078] ACCAGGAGAGAAGACAGAAGttgatggaggaaattcgtgaattgaa...
Embodiment 3
[0091] Example 3 Detection of ZNF644 gene 1901-position A→G mutation, 2180-position C→G mutation, 2238-position G→A mutation, 4138-position C→G mutation and 4718-position G→A mutation
[0092] 1. Detection method
[0093] 1. Extract blood genome DNA from 300 sporadic high myopia patients and 600 normal controls
[0094]2. ZNF644 gene 1901 A→G mutation site, 2180 C→G mutation site, 2238 G→A mutation site, 4138 C→G mutation site and 4718 G→A mutation site The detection method of these 5 mutation sites is the same as the detection method of the 2156 A→G mutation site of the ZNF644 gene in Example 2, and their PCR amplification primers, amplification products and sequencing primers are respectively:
[0095] 1901 A→G mutation site:
[0096] PCR amplification primer: the sequence (primer pair A) shown in SEQ ID NO.1~2, same as the amplification primer at position 2156;
[0097] Amplified product: the sequence shown in SEQ ID NO.6-7 (879bp)
[0098] ACCAGGAGAGAAGACAGAAGttgatggag...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Diopter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 