Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor

A multi-drug resistance and transcription factor technology, applied in the direction of antineoplastic drugs, drug combinations, medical preparations containing active ingredients, etc., can solve the problems of unseen applications and achieve the effect of less toxic and side effects

Active Publication Date: 2014-07-09
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no application of transcription factor NFAT as a drug target in reversing tumor multidrug resistance at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor
  • Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor
  • Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Detection of MDR1 mRNA transcription level in multidrug resistant tumor cells

[0026] experimental method:

[0027] Take MCF-7 / WT and MCF-7 / ADM respectively 1×10 5According to the method described in the operation manual of Trizol Reagent reagent, the total RNA of the above-mentioned cells was extracted; according to the method described in the operation manual of the reverse transcription kit iScript TM cDNA Synthesis Kit, the total RNA of the above-mentioned extracted cells was reverse-transcribed to obtain cDNA , the reverse transcription primer is the universal primer that comes with the above kit.

[0028] The mRNA transcript level of P-gp in MCF-7 / WT and MCF-7 / ADM was detected by Real-time fluorescent quantitative PCR. Real-time PCR amplification was carried out on the iCycler iQ fluorescent quantitative PCR instrument. Fluorescent quantitative PCR primer design: the upstream primer is 5'-GCCGGGAGCAGTCATCTGTGG T-3', the downstream primer is 5'-GAT C...

Embodiment 2

[0031] Example 2 Prediction and confirmation of transcription factor NFATC3 binding to MDR1 promoter region

[0032] experimental method:

[0033] The transcription factor binding site prediction software TESS (Transcription Element Search System) was used to predict the binding site of NFATC3 and MDR1 promoter region.

[0034] Using MCF-7 / WT and MCF-7 / ADM as samples, the combination of NFATC3 and MDR1 promoter was detected according to the method described in the operation manual of the nucleic acid protein precipitation kit chromatin Immunoprecipitation Assay kit, that is, the chromosome immunoprecipitation (CHIP) was first used technology to precipitate chromatin fragments associated with target proteins, and then detect the precipitated chromatin fragments by PCR. The experimental group and the control group were set up. The experimental group used NFATC3 antibody as the incubation antibody, and the control group used New Zealand rabbit pre-immune serum IgG (purified by ...

Embodiment 3

[0037] Example 3 Activation of transcription factor NFATC3 by extracellular calcium influx mediated by TRPC5

[0038] experimental method:

[0039] HEK293 cells stably expressing TRPC5 were seeded in 24-well plates at a density of 30,000 cells per well and placed in 5% CO 2 Co-transfection was carried out after culturing in a constant temperature cell incubator for 12 hours. The co-transfection system was: 0.2 μg reporter plasmid (mdr1-luc or NFAT-binding site deletion plasmid ΔTTTTCC-mdr1-luc, where ΔTTTTCC-mdr1-luc was obtained using site-specific The mutation kit Quick Change Site-directed Mutagenesis Kit was obtained by performing deletion mutation on the bases in the binding site region predicted by TESS in Example 2 according to the method described in the kit’s operation manual. The primer design: the upstream primer is 5’- GTAAACAAATGAATTTCCATAAAGCTAATTTATCTTTATAATACTTATTACTTCAAATTCTTGTTACATTT-3',下游引物为5'-AAATGAACAA GAATTTGAAGTAATAAGTATTATAAAGATAAATTAGCTTTATGGAAATTCATT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention provides a new application of transcription factor NFATC3, that is, the application of transcription factor NFATC3 as a drug target in reversing tumor multidrug resistance, and the drug is an NFATC3 inhibitor, including tacrolimus and cyclosporine A or VIVIT, the multidrug resistance of the tumor is mediated by P-gp. The important point of the present invention is to find that the transcription factor NFATC3 is closely related to tumor multidrug resistance, and NFATC3 inhibitors have obvious reversal effect on multidrug resistance of tumor cells, and the above-mentioned inhibitors themselves have very little toxic and side effects, so , the present invention provides a new target for the design of new anti-tumor multi-drug resistance drugs, and provides a new idea for the reversal of tumor multi-drug resistance.

Description

technical field [0001] The present invention relates to a new application of transcription factor NFATC3, in particular to the application of transcription factor NFATC3 inhibitor in the preparation of tumor multidrug resistance reversing medicine. Background technique [0002] Tumor is a kind of disease that seriously endangers human health, ranking first among various causes of death. At present, there are a large number of people suffering from cancer in our country, and more than 1.6 million people die from cancer every year. There are about 200 kinds of anti-tumor drugs that have been approved for marketing in my country. However, with the wide application of tumor chemotherapy drugs, the problem of multi-drug resistance of tumors has become prominent, and it has become one of the most common and difficult problems in the failure of tumor chemotherapy. According to statistics, more than 90% of cancer patients died of drug resistance to varying degrees. [0003] Tumor m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61K31/436A61K38/13A61P35/00
Inventor 金坚马鑫陈蕴何冬旭蔡燕飞
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap