Unlock instant, AI-driven research and patent intelligence for your innovation.
Kit for detecting human cytomegalovirus (HCMV)
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of human cytomegalovirus and detection kit, which is applied in the direction of determination/inspection of microorganisms, microorganisms, biochemical equipment and methods, etc., can solve the problems of low detection sensitivity and lack of quality control system of the kit, and achieve detection sensitivity High performance, simple method and wide detection range
Active Publication Date: 2014-08-13
SANSURE BIOTECH INC
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0007] At present, kits for the quantitative detection of HCMV-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acids, and the detection sensitivity is not high, about 500~1000copies / ml In addition, most of these kits lack a complete quality control system, and further improvement and technical level are needed to make such products more meet the needs of clinical and accurate diagnosis
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0024] This embodiment provides a specific human cytomegalovirus detection kit, which includes the following components:
[0025] ①HCMV Concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.
[0026] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.
[0027] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+04copies / ml, and the 100 base pair sequence is: 5'-CACCACTTAAATCCTAAGGTTCCAGCTCTGTCATCCAGTTTTGCTGACTCACGTATTCGTAGCAATCTTCTGGAGGTGCAATCTCAATTATGTCATCAG-3'.
[0028] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target pol...
Embodiment 2
[0034] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting HCMV-DNA in unknown samples such as serum, urine and peripheral blood:
[0035] 1. Reagent preparation
[0036] According to the number of samples to be tested, HCMV negative control, HCMV positive control, and HCMV quantitative reference materials A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 1.0 μl / person and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.
[0037] 2. Nucleic acid extraction
[0038] 1. Urine sample: Take 1ml sample, centrifuge at 12,000rpm for 5 minutes, discard the supernatant, add 50μl of nucleic acid release agent to the pellet, shake the pe...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a kit for detecting a human cytomegalovirus (HCMV). The kit contains a nucleic acid releasing agent and a PCR (Polymerase Chain Reaction) liquid; the nucleic acid releasing agent contains 0.01-0.5mM / L of surfactin, 20-300mM / L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol; and the PCR liquid contains an upstream primer and a downstream primer which are used for amplifying target polynucleotide and a probe for detecting the target polynucleotide. The sensitivity of the kit for detecting the HCMV can be up to 400copies / ml, and the kit has the quantitative linearity range of 400-4.00E+09copies / ml; and by using the kit, the HCMV-DNA in an unknown sample such as serum, urine, peripheral blood and the like can be rapidly and accurately detected, the reliable experiment basis can be provided for good birth and good care as well as the early diagnosis of HCMV infection.
Description
technical field [0001] The invention provides a human cytomegalovirus HCMV detection kit, in particular a fluorescent PCR-based HCMV-DNA detection kit. Background technique [0002] Human cytomegalovirus (HCMV), also known as cell inclusion body virus, is a double-helical DNA virus of the genus β in the family Herpesviridae. Because the infected cells are enlarged and have huge nuclear inclusion bodies, they are called giant cells Virus. CMV can infect humans and other mammals, but has a high degree of host specificity, and humans are the only host of HCMV. Most people have been infected with HCMV, but most of them are acute infection or latent infection without clinical symptoms, and most of them acquire immunity due to infection in childhood. HCMV is an opportunistic pathogenic virus. The virus can remain latent in the body for a long time, and even carry the virus for life. However, in people with immature or deficient immune functions (such as AIDS and organ transplant...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More