Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant protein against multiplication of porcine pseudorabies virus and its application

A porcine pseudorabies virus and recombinant protein technology, which is applied in the field of genetic engineering, can solve the problems of disease recurrence, immunosuppression, and the inability of vaccine strains to obtain a satisfactory immune protection response, and achieve a significant inhibitory effect.

Inactive Publication Date: 2016-03-02
HUBEI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] ①The main virulence gene TK still exists, and the virulence may become stronger;
[0006] ② Vaccine strains that are not sufficiently attenuated or overly attenuated not only cannot obtain a satisfactory immune protection response, but may cause disease re-emergence or immunosuppression;
[0007] ③The attenuated vaccine can still form a latent infection, and there is a possibility of shedding the virus. There are neutralizing antibodies in the serum of some vaccinated pigs, but they can still shed the virus for several years
However, with the variation of pseudorabies strains and other reasons, the existing vaccines sometimes cannot provide complete immune protection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein against multiplication of porcine pseudorabies virus and its application
  • Recombinant protein against multiplication of porcine pseudorabies virus and its application
  • Recombinant protein against multiplication of porcine pseudorabies virus and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Bioinformatics analysis Design protein molecules and related genes for their synthesis.

[0046] The N-terminal domain of protein kinase R (proteinkinaseR, PKR) contains two dsRNA binding domains; the C-terminal has a kinase domain. After binding dsRNA, PKR protein phosphorylates eIF-2alpha after autophosphorylation, which then prevents the translation of viral proteins. Apoptotic protein activating factor (apoptoticproteaseactivatingfactor1, Apaf-1) can simultaneously bind many procaspases. These procaspases activate themselves by cleavage, which then enzymatically cleaves many cellular proteins, thereby killing the cell. When the dsRNA-binding domains and procaspases-binding domains of these two factors are combined into a fusion protein, cells transfected with the protein can immediately initiate the apoptosis process when encountering dsRNA.

[0047] Retrieve the porcine PKR gene (gi|47523704) and Apaf-1 gene (gi|350584646) on NCBI, analyze their domains...

Embodiment 2

[0050] Embodiment 2 expresses and purifies this protein with prokaryotic expression vector pET-28a

[0051] The gene was amplified using a pair of primers as follows:

[0052] sDRACO-1:GACGGGCCGAAGCTTGCTATG

[0053] sDRACO-2:GATCCGACGTCTTAGGAAGAAG

[0054] The cloned gene was connected to the pMD18-T vector, digested by HindIII and XhoI and then connected to the pET-28a expression vector. After the sequence verification was correct, it was transformed into a BL21 expression strain. After IPTG induced expression, SDS-PAGE confirmed the successful expression ( figure 1 ). Continue to analyze the solubility of the recombinant protein: the recombinant strain was induced to express with IPTG, ultrasonically crushed, centrifuged, the supernatant and precipitate were collected, and the solubility of the protein was analyzed. The results of SDS-PAGE showed that at 34.5KD, both the supernatant and the precipitate had a band ( figure 2 ). Cultivate 350ml of the recombinant strain...

Embodiment 3

[0055] Example 3 Cell experiments confirmed that the protein (sDRACO) has the ability to significantly inhibit the proliferation of porcine pseudorabies virus

[0056] Proceed as follows:

[0057] 1) The cells cultured for 48 hours into a good monolayer were digested into single cells by trypsin, spread on a 96-well plate, and the antiviral experiment was carried out when the cells grew to 50-80%;

[0058] 2) Do a series of 10-fold dilutions of the PRV virus;

[0059] 3) Antiviral experiment: the experimental group was added with sDRACO and PRV at the same time, and the control group was added with the same amount of PBS and PRV;

[0060] 4) Observe and record the time of cell lesion and the number of holes;

[0061] When the virus was added at a dose of 10 11.5 When TCID50, some cells did not have pathological changes, while all cells in the corresponding control group were pathological ( image 3 ).

[0062] The virus in each well was collected separately, the viral DNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant protein for resisting porcine pseudorabies virus reproduction, and application of the recombinant protection to synthesis of a medicine for resisting porcine pseudorabies virus reproduction. The recombinant protein for resisting porcine pseudorabies virus reproduction is a protein with an amino acid sequence consisting of an amino acid sequence shown as SEQ ID No.2, a protein with an amino acid sequence which has homology of 95-100 percent with the amino acid sequence limited by the sequence SEQ ID No.2, and is used for coding proteins with same functions, or a protein which is derived from the amino acid sequence shown as SEQ ID No.2 through addition, deletion or substitution of one or more amino acids and has equal activity. The recombinant protein provided by the invention is used in the medicine for resisting the porcine pseudorabies virus reproduction; experiments prove that the recombinant protein has a remarkable inhibition effect.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant protein for resisting the proliferation of porcine pseudorabies virus, which is used in the synthesis of medicines for resisting porcine pseudorabies virus. Background technique [0002] Pseudorabies (PR) was first discovered in cattle herds in the United States in 1813. The clinical symptoms of sick cattle were extremely itchy, so this disease is also called "crazy scrapie". In 1902, the Hungarian scientist Aujeszky first isolated the virus, so PR is also known as Aujeszky's disease (Aujeszky'sdisease, AD). In 1934, Sabin and Wright experimentally verified that the virus was a herpes virus, which was later named swine herpes virus (SHV-1) or pseudorabies virus (Pseudorabies virus, PRV). Protein sequencing analysis showed that PRV has high homology with equine herpesvirus (EHV-1), bovine herpesvirus (BHV-1), and varicella virus (VZV). The host of PRV includes ot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/47C12N15/12C12N15/70C12N1/21A61K48/00A61K35/74A61P31/22C12R1/19A61K38/16
CPCA61K38/00C12N9/1205
Inventor 魏子贡魏荣展杨德明李文献
Owner HUBEI UNIV