Feed additive for preventing white spot syndrome and preparation method thereof

A feed additive, a technology for shrimp white spot disease, which is applied in the field of genetic engineering, can solve the problems of loss of antigenic activity and cannot be maintained, and achieves the effect of reducing damage and facilitating large-scale cultivation and production.

Active Publication Date: 2014-05-07
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most studies have used prokaryotes—bacteria as expression vectors for the expression of WSSV envelope proteins, but the use of prokaryo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Feed additive for preventing white spot syndrome and preparation method thereof
  • Feed additive for preventing white spot syndrome and preparation method thereof
  • Feed additive for preventing white spot syndrome and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0018] 1) Cloning of WSSV envelope protein gene

[0019] According to the WSSV sequence included in GenBank (GenBank accession number: AF332093), the following primers VP28F (NcoI): CTCGCCATGGATCTTTCTTTCACTCTTT, VP28R (NheI): GATTGCTAGCATGTTTCCCGTTCAA were synthesized.

[0020] Litopenaeus vannamei carrying white spot virus was used as the material, and DNA was extracted from the hepatopancreas of the shrimp by CTAB method. Using the hepatopancreas tissue DNA as a template, VP28F (NcoI) and VP28R (NheI) were used for PCR amplification to obtain the DNA sequence of the VP28 gene. The amplification procedure was: denaturation at 94°C for 2 min; Extension at ℃ for 45s, 5 cycles; denaturation at 94℃ for 30s, annealing at 60℃ for 45s, extension at 72℃ for 45s, 30 cycles; extension at 72℃ for 10min.

[0021] The PCR product was purified using a column-type PCR product purification kit (Shanghai Sangon Biotechnology Service Co., Ltd.), and ligated into the pMD 18-T vector (Bao Bioen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to gene engineering and especially relates to a feed additive for preventing white spot syndrome and a preparation method thereof. The preparation method comprises that a hepatopancreas tissue DNA of Penaeus vannamei Boone infected with white spot syndrome is used as a template, a PCR amplification process is carried out by primers of VP28F(NcoI) and VP28R(NheI), the amplification product shown in the formula of SEQ ID No.1 is modified and the modified amplification product is transferred to paddy rice, the transgenic regenerated seedling with the amplification product is planted, and rice bran is collected and is used as the feed additive. The primer VP28F(NcoI) has a sequence formula of CTCGCCATGGATCTTTCTTTCACTCTTT and primer VP28R(NheI) has a sequence formula of GATTGCTAGCATGTTTCCCGTTCAA. The preparation method selects paddy rice as a bioreactor for expression of a white spot syndrome virus (WSSV) envelope protein gene so that accurate expression of the exogenous gene is guaranteed and large-scale culture and production are easy.

Description

technical field [0001] The invention relates to genetic engineering, in particular to a feed additive for preventing white spot disease of prawns and a preparation method thereof. Background technique [0002] Shrimp white spot syndrome (WSS) is a devastating disease that endangers the global shrimp farming industry. Its pathogen is shrimp white spot syndrome virus (WSSV). RMB. So far, there is no effective treatment for white spot disease of prawns. [0003] As early as 1999, from the perspective of basic research on shrimp immunity, Wang Lei and others found that heat-inactivated WSSV and virus structural proteins could stimulate the activity of lysozyme and the production of superoxide dismutase in the serum of Chinese prawn (Fenneropenaeus chinensis) significantly. It can be seen that the inactivated WSSV or its structural protein can activate the immune system of prawns. Subsequently, studies on the use of envelope proteins to stimulate the disease resistance of praw...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A23K1/18A23K1/14A23K1/16C12N15/34C12N15/82A01H5/00
Inventor 刘梅刘文真王雷付亚萍王宝杰胡国成蒋克勇
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap