MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent
A detection reagent and active technology, which can be used in DNA/RNA fragmentation, recombinant DNA technology, and the determination/inspection of microorganisms. It can solve the problems of large expression differences and complex microRNA detection technology, achieving high sensitivity and Improve the efficiency of diagnosis and the effect of fast operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0042] The microRNA and its relative expression multiple detection and its specific application described in the present invention will be further described below in conjunction with specific examples, but it is not intended as a limitation of the present invention.
[0043] The microRNAs described in this example include miR-132*, miR-630, miR-572 and miR-362-3p.
[0044] The sequence of the miR-132* is accguggcuuucgauuguuacu;
[0045] The sequence of miR-630 aguauucuguaccagggaaggu;
[0046] The sequence of miR-572 is guccgcucggcgguggccca;
[0047] The sequence of miR-362-3p is aacacaccuauucaaggauuca.
[0048] This embodiment also includes the detection of U6snRNA reference gene expression, and the U6snRNA is used to calculate the relative expression change fold of specific microRNA.
[0049] The microRNA described in this example is derived from human cells, and its extraction method is the RNA separation and extraction method commonly used by those skilled in the art.
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 