MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent

A detection reagent and active technology, which can be used in DNA/RNA fragmentation, recombinant DNA technology, and the determination/inspection of microorganisms. It can solve the problems of large expression differences and complex microRNA detection technology, achieving high sensitivity and Improve the efficiency of diagnosis and the effect of fast operation

Active Publication Date: 2014-09-03
FUDAN UNIV +1
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Due to the complexity of microRNA detection technology, the expression of different microRNAs on diseases is quite different. Therefore, further research on microRNAs related to tuberculosis infection is urgently needed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent
  • MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent
  • MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0042] The microRNA and its relative expression multiple detection and its specific application described in the present invention will be further described below in conjunction with specific examples, but it is not intended as a limitation of the present invention.

[0043] The microRNAs described in this example include miR-132*, miR-630, miR-572 and miR-362-3p.

[0044] The sequence of the miR-132* is accguggcuuucgauuguuacu;

[0045] The sequence of miR-630 aguauucuguaccagggaaggu;

[0046] The sequence of miR-572 is guccgcucggcgguggccca;

[0047] The sequence of miR-362-3p is aacacaccuauucaaggauuca.

[0048] This embodiment also includes the detection of U6snRNA reference gene expression, and the U6snRNA is used to calculate the relative expression change fold of specific microRNA.

[0049] The microRNA described in this example is derived from human cells, and its extraction method is the RNA separation and extraction method commonly used by those skilled in the art.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention further discloses a microRNA (Ribose Nucleic Acid) sequenced as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4 and an application of the microRNA in preparation of an active tuberculosis detection reagent. The active tuberculosis detection kit comprises an amplification specificity primer, a real-time PCR (Polymerase Chain Reaction) kit and an internal reference primer, and can further comprise a microRNA reverse transcription system and a buffer solution. The content of the microRNA is specially detected via a real-time PCR relative quantitative method; and the microRNA is compared with the internal reference microRNA so as to detect the tuberculosis. The microRNA disclosed by the invention has the high sensitivity and the high accuracy for detecting the active tuberculosis and is rapid in detection speed, so that the diagnostic efficiency of the active tuberculosis can be greatly improved.

Description

technical field [0001] The invention relates to the field of biological treatment, in particular to a microRNA related to tuberculosis infection and its application in the preparation of active tuberculosis detection reagents. Background technique [0002] Tuberculosis is still one of the major infectious diseases threatening human health, and there are still millions of new tuberculosis cases worldwide every year. my country has invested a lot of manpower and material resources in the prevention and control of tuberculosis. Although my country widely inoculates BCG and treats tuberculosis patients according to WHO standards, the number of people who die from tuberculosis every year still hovers in the top three of major infectious diseases. . Especially in recent years, with the prevalence of drug-resistant tuberculosis and multidrug-resistant tuberculosis strains, and the increase of tuberculosis and AIDS co-infection, the problem of tuberculosis has become more complicate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12Q1/68
Inventor 张文宏吴晶陈嘉臻王森
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap