Supercharge Your Innovation With Domain-Expert AI Agents!

A calmodulin gene and its application

A calmodulin and gene technology, applied in the field of genetic engineering, achieves the effect of small environmental impact, low technical cost and easy operation

Active Publication Date: 2017-01-04
KUNMING UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method is difficult to completely solve the problems of soil acidity and aluminum toxicity, and there are also potential environmental problems.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A calmodulin gene and its application
  • A calmodulin gene and its application
  • A calmodulin gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: Cryptococcus terrestris ( C . humicolus ) Cloning and identification of CaM gene of BSLL1-1 strain

[0022] A strain of Cryptococcus terrestris with high resistance to aluminum ions was isolated from the acidic soil in the rhizosphere of tea trees in the surrounding tea gardens of Longling County, Baoshan City, Yunnan Province ( C . humicolus) BSLL1-1 strain, about 0.1 g of bacterial material was collected, and 500 μg of total RNA was extracted with TRIzoL kit (Invitrogen Company), and then mRNA was isolated with PoylATract mRNA Isolation systems kit (Pormega Company). The positive SSH cDNA library of Cryptococcus terrestris was constructed with aluminum-treated Cryptococcus terrestris as the test side and without aluminum treatment as the subtractive side.

[0023] 1. Synthesis of the first strand of cDNA

[0024] Take 2 μg of mRNA from the test side and subtraction side respectively, and use AMV reverse transcriptase to reverse transcribe the mRNA ...

Embodiment 2

[0071] Example 2: Heterologous expression of CaM protein

[0072] In order to facilitate the construction of expression vectors, design specific primers according to the nucleotide sequence, and introduce them at the 5' ends of the upstream and downstream primers respectively. Eco RI and xho I restriction site, the primer sequence is as follows: Forward primer CaM-F: 5'-CG GAATTC ATGGCGGAGCAGCTGACCAAG-3' (underlined Eco RI restriction site), reverse primer CaM-R: 5'-GGC CTCGAG TTACTTGGCCATCATCATGGTAAC -3' (underlined as xho I restriction site). The CaM gene fragment was amplified using the cDNA of Cryptococcus terrestris as template. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 45 s, followed by 10 min at 72°C after the cycle. The PCR product of the CaM gene was subcloned into the pMD18-T vector, and the obtained TA cloning...

Embodiment 3

[0075] Example 3: Construction and detection of CaM transgenic yeast

[0076] use Eco RI and xho I digested and sequenced the correct pMD-18T-CaM plasmid, and recovered the target gene CaM fragment. use Eco RI and xho I digest the yeast expression vector plasmid pYES3 / CT, recover the linear vector pYES3 / CT fragment, and then perform a ligation reaction between the two to obtain the pYES3 / CT-CaM plasmid. The band of the target fragment size ( figure 2 A), indicating that the target gene was successfully connected to the yeast expression vector. The pYES3 / CT-CaM plasmid carrying the CaM gene was electroporated into Saccharomyces cerevisiae INVSc1 competent cells. Grow on the SD-Trp plate for 2-3 days, pick a single colony, cultivate overnight at 30°C, collect the bacteria and extract the total protein, and use CaM antibody for Western blotting detection, and the target protein band can be detected in the transgenic yeast strain ( figure 2 B), showing that exogenous...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a calmodulin gene, which is cloned in Cryptococcus terrestris BSLL1‑1 strain, its nucleotide sequence is shown in SEQ ID NO: 1, and its encoding is shown in SEQ ID NO: 2 amino acid sequence of proteins; the protein is expressed in Escherichia coli, and the gene is further successfully expressed in Saccharomyces cerevisiae, the gene increases the aluminum tolerance of Saccharomyces cerevisiae, and the genetically engineered bacteria can absorb (or absorb) the activity in the culture medium Aluminum, the Saccharomyces cerevisiae genetically engineered strain has the application potential of reducing the content of active aluminum in acidic soil.

Description

technical field [0001] The present invention belongs to the field of genetic engineering, and specifically relates to an aluminum-resistant gene encoding calmodulin of Cryptococcus terrestris, a nucleotide sequence and an amino acid sequence, and heterologous expression of an aluminum-resistant protein, and relates to a recombinant plasmid containing the gene and expression The engineering strains of the aluminum resistance gene, their preparation and expression methods, and their application of active aluminum in the adsorption environment. Background technique [0002] Acidic soils are widespread in the world, of which the arable area is 179 million hm 2 . The distribution of acidic soil in my country covers 14 provinces and regions, accounting for about 21% of the country's cultivated land (Xiong Yi and Li Qingkui, 1987). Excessive application of nitrogen fertilizer is the main cause of soil acidification in farmland. In addition, the acid rain caused by the developmen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/81C12N1/19B09C1/10C12R1/865
Inventor 年洪娟张磊张晶晶陈丽梅
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com