Application of zmwrky50 gene to improve plant aluminum tolerance
An acid-resistant aluminum, plant technology, applied in applications, plant products, genetic engineering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] 1. Acquisition and cloning of ZmWRKY50 gene sequence
[0022] In the maizesequence database, the cDNA and protein sequences of the ZmWRKY50 gene were obtained.
[0023] The cDNA sequence of ZmWRKY50 gene was analyzed, and the primer W50F / R was designed. W50F: tatctagagacaaacacctcccaaccc; W50R: atgagctcctccctctttctacaaccttcttc;
[0024] Using the cDNA of maize inbred line 178 as a template, the ZmWRKY50 gene was specifically amplified.
[0025] The reaction system is:
[0026] Table 1 PCR reaction system
[0027]
[0028] The PCR reaction program is: 95°C for 3min; 95°C for 30sec, 60°C for 30sec, 72°C for 1.5min and 35cycles; 72°C for 5min. The PCR product was detected by 1.0% agarose gel electrophoresis, and the target band was recovered using the agarose gel recovery kit of Omega Company.
[0029] Amplification of the ZmWRKY50 gene
[0030] Use the specific primer W50F / R of ZmWRKY50 to amplify the cDNA of these two genes from maize inbred line 178, obtained th...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com