Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of zmwrky50 gene to improve plant aluminum tolerance

An acid-resistant aluminum, plant technology, applied in applications, plant products, genetic engineering, etc.

Inactive Publication Date: 2015-09-30
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, it has been found that maize WRKY gene is related to maize disease and salt resistance, but there is no report related to antacid aluminum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of zmwrky50 gene to improve plant aluminum tolerance
  • Application of zmwrky50 gene to improve plant aluminum tolerance
  • Application of zmwrky50 gene to improve plant aluminum tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] 1. Acquisition and cloning of ZmWRKY50 gene sequence

[0022] In the maizesequence database, the cDNA and protein sequences of the ZmWRKY50 gene were obtained.

[0023] The cDNA sequence of ZmWRKY50 gene was analyzed, and the primer W50F / R was designed. W50F: tatctagagacaaacacctcccaaccc; W50R: atgagctcctccctctttctacaaccttcttc;

[0024] Using the cDNA of maize inbred line 178 as a template, the ZmWRKY50 gene was specifically amplified.

[0025] The reaction system is:

[0026] Table 1 PCR reaction system

[0027]

[0028] The PCR reaction program is: 95°C for 3min; 95°C for 30sec, 60°C for 30sec, 72°C for 1.5min and 35cycles; 72°C for 5min. The PCR product was detected by 1.0% agarose gel electrophoresis, and the target band was recovered using the agarose gel recovery kit of Omega Company.

[0029] Amplification of the ZmWRKY50 gene

[0030] Use the specific primer W50F / R of ZmWRKY50 to amplify the cDNA of these two genes from maize inbred line 178, obtained th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant stress resistance, and particularly relates to an application of a ZmWRKY50 gene in improving the acid aluminum resistance of a plant. The result of RT-qPCR detection proves that the expression of the ZmWRKY50 gene experiences different degrees of induction and inhibition of AlCl3. Along with the continuously increasing AlCl3 concentration, the expression of the ZmWRKY50 gene is increased and then decreased. When the AlCl3 concentration is excessively high, severe toxic action is generated on the plant, and the expression of the ZmWRKY50 gene is correspondingly inhibited, thereby indicating that the expression of the ZmWRKY50 gene is induced in a proper range of AlCl3 concentration; and the acid aluminum stress on the plant is subjected to positive control so as to improve the acid aluminum resistance of the plant.

Description

technical field [0001] The invention relates to the field of plant stress resistance, in particular to the application of the ZmWRKY50 gene to improve the aluminum tolerance of plants. Background technique [0002] As an important food, feed and economic ternary crop in my country, corn is affected by various adverse external environments such as pests, drought, salt damage, cold damage, and high temperature during its growth, thereby inhibiting its growth and development. Applying modern molecular biology techniques to excavate important stress-resistant genes and carry out genetic transformation or aggregate them with other excellent traits through molecular marker-assisted selection is one of the effective methods to obtain maize varieties with strong stress tolerance and improve maize yield. one. Functional research on stress-related genes is a prerequisite for the development and utilization of these genes. WRKY transcription factors play an important regulatory role ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00
Inventor 张素芝黄凤珠王娜王雷张辰路李洪有黄盈邱林权解光宁张晓霞
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com