Unlock instant, AI-driven research and patent intelligence for your innovation.

Barley hvals1 gene and its use

A barley and gene technology, applied in the field of genetic engineering, can solve the problems of few aluminum-resistant genes, sensitivity to aluminum hordeate stress, and few reports

Active Publication Date: 2020-06-23
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the current genetic engineering technology provides technical support for our selection of acid-resistant aluminum varieties (Delhaize et al., 2004), there are still very few aluminum-resistant genes identified so far. Major Obstacles Faced by Aluminum Varieties
[0004] In response to acid-aluminum stress, plants themselves have formed many detoxification mechanisms, including internal and external detoxification. Among these mechanisms, the most thoroughly studied is the secretion of organic acids, which can chelate aluminum in the rhizosphere. Many genes regulating organic acid secretion have also been identified, such as the HvAACT1 gene in barley (Furukawa et al., 2007), the TmALMT1 gene in wheat (Sasaki et al., 2004), etc., although these external detoxification mechanisms can chelate most of the Al , but there is still a part of aluminum that enters the plant, so there are many internal detoxification mechanisms in plants, but there are still few reports on the internal aluminum detoxification mechanism of barley
[0005] Barley (Hordeum vulgare L.) is the fourth largest cereal crop after maize, rice and wheat, but barley is extremely sensitive to anodic acid stress, which severely limits the cultivation of barley in many acid soil agricultural regions around the world. Therefore, we There is an urgent need to screen aluminum-tolerant germplasm and explore aluminum-tolerant related genes to breed aluminum-tolerant barley varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Barley hvals1 gene and its use
  • Barley hvals1 gene and its use
  • Barley hvals1 gene and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Cloning and Analysis of CDS Region and Promoter Sequence of HvALS1 Gene

[0034] 1. Cloning of CDS region sequence of HvALS1 gene

[0035] Based on the previous research of the research group, a differentially expressed gene in the Al-tolerant genotype (XZ16) and Al-sensitive genotype (XZ61) under Al stress conditions was selected from the root gene chip structure, and a highly expressed ABC in the Al-tolerant genotype was selected. Family gene, the full-length CDS region sequence of this gene was cloned from XZ16 (as shown in SEQ ID NO. 1), and it was named as HvALS1.

[0036] Total RNA from the roots of annual wild barley XZ16 on the Qinghai-Tibet Plateau was extracted using a total RNA extraction kit (Takara, Japan), and genomic DNA contamination in the total RNA was removed with DNaseI (Takara, Japan). PrimeScripffM II 1stStrand cDNA Synthesis Kit reverse transcription kit ( Takara, Japan) reverse transcribed the extracted total RNA into single-stranded cDNA. Desi...

Embodiment 2

[0056] Verification of HvALS1 gene function by BSMV-VIGS method

[0057] 1. Construction of BSMV:HvALS1 vector

[0058] Total RNA from XZ16 roots was extracted using a total RNA extraction kit (Takara, Japan), and genomic DNA contamination in the total RNA was removed with DNaseI (Takara, Japan), using PrimeScript TM II 1st Strand cDNA Synthesis Kit Reverse Transcription Kit (Takara, Japan) reverse-transcribes total RNA into cDNA. Primers were designed according to the results of Blast, and a 262bp HvALS1 gene fragment was obtained by amplification.

[0059] KOD enzyme PCR reaction system:

[0060]

[0061] The amplification program was: 94°C for 5 min, (98°C for 10s, 58°C for 30s, 68°C for 30s) for 35 cycles, and 68°C for 10 min.

[0062] The primer sequences are (underlined are the restriction sites):

[0063] HvALS1-γ-F: 5'-GTAC GCTAGC CAAAACATGACGCCGGGAAG-3' (SEQ ID No: 10);

[0064] HvALS1-γ-R: 5'-GTAC GCTAGC CGAGCAACGACTCTCTCACT-3' (SEQ ID No: 11).

[0065] ...

Embodiment 3

[0083] HvALS1 gene overexpression

[0084] 1. Construction of overexpression vector

[0085] The method for constructing the overexpression vector in this experiment is Gateway. Total RNA of barley variety Golden Promise was extracted, reverse transcribed into cDNA, and primers for overexpression vector of HvALS1 gene were designed, and cDNA was used as template to amplify the target gene. After sequence alignment, the CDS sequence of the Golden Promise HvALS1 gene was identical to that of XZ16.

[0086] Wherein the overexpression primer of HvALS1 gene amplifies the target fragment primer sequence of 1935bp as follows:

[0087] AttB-F-Overexpression-HvALS1:GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGTGAGGGAGCTGCGC (SEQ ID No: 13);

[0088] AttB-R-Overexpression-HvALS1:GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTGGCCATTACTGCTGG (SEQ ID No: 14).

[0089] The position of the bands was detected by 1% agarose gel electrophoresis on the products amplified by PCR, the target gene was recovered and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a barley HvALS1 gene and a use thereof in enhancing aluminum tolerance of barley, belonging to the technical field of genetic engineering. The nucleotide sequence of the CDS region of the barley HvALS1 gene is shown in SEQ ID NO. 1. The invention combines the cloning and analysis of barley HvALS1 gene with BSMV-Vigs gene silencing and Agrobacterium tumefaciens-mediated overexpression are used to verify the function of the gene. BSMV-VIGS-The results showed that HvALS1 gene is closely related to barley acid-aluminum tolerance, which provided theoretical basis and relatedgenes for barley acid-aluminum tolerance breeding and production.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the barley HvALS1 gene and its use in enhancing the aluminum tolerance of barley. Background technique [0002] Aluminum is the most abundant metallic element in the earth's crust, accounting for about 8% (Mannello et al., 2011). In a neutral environment, aluminum in the soil mainly exists in the form of silicates or oxides, which are non-toxic to plants. However, when the pH of the external environment is less than 5.5, the combined aluminum will gradually dissociate Al in ionic state 3+ , and this ionic Al 3 + It is toxic to the growth of plants, and its most significant symptom of toxicity is to inhibit the elongation of plant roots, thereby inhibiting the absorption of water and nutrients by plants (Kochian, 1995), thereby affecting the overall growth and development of plants and reducing plant growth. Yield. Therefore, Al 3+ It is considered to be one of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8271
Inventor 刘文星邬飞波曹方彬冯雪戴华鑫张国平
Owner ZHEJIANG UNIV