Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Barley HvALS1 gene and use thereof

A barley and gene technology, applied in the field of genetic engineering, can solve the problems of barley aluminum phosphate stress sensitivity, few reports, restricted barley planting, etc.

Active Publication Date: 2019-01-11
ZHEJIANG UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the current genetic engineering technology provides technical support for our selection of acid-resistant aluminum varieties (Delhaize et al., 2004), there are still very few aluminum-resistant genes identified so far. Major Obstacles Faced by Aluminum Varieties
[0004] In response to acid-aluminum stress, plants themselves have formed many detoxification mechanisms, including internal and external detoxification. Among these mechanisms, the most thoroughly studied is the secretion of organic acids, which can chelate aluminum in the rhizosphere. Many genes regulating organic acid secretion have also been identified, such as the HvAACT1 gene in barley (Furukawa et al., 2007), the TmALMT1 gene in wheat (Sasaki et al., 2004), etc., although these external detoxification mechanisms can chelate most of the Al , but there is still a part of aluminum that enters the plant, so there are many internal detoxification mechanisms in plants, but there are still few reports on the internal aluminum detoxification mechanism of barley
[0005] Barley (Hordeum vulgare L.) is the fourth largest cereal crop after maize, rice and wheat, but barley is extremely sensitive to anodic acid stress, which severely limits the cultivation of barley in many acid soil agricultural regions around the world. Therefore, we There is an urgent need to screen aluminum-tolerant germplasm and explore aluminum-tolerant related genes to breed aluminum-tolerant barley varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Barley HvALS1 gene and use thereof
  • Barley HvALS1 gene and use thereof
  • Barley HvALS1 gene and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Cloning and Analysis of CDS Region and Promoter Sequence of HvALS1 Gene

[0034] 1. Cloning of the CDS region sequence of HvALS1 gene

[0035] Based on the previous research of the research group, a differentially expressed gene between the aluminum-tolerant genotype (XZ16) and the aluminum-sensitive genotype (XZ61) under aluminum stress conditions was selected from the root gene chip structure, and ABC was highly expressed in the aluminum-tolerant genotype Family gene, the full-length CDS region sequence of the gene (as shown in SEQ ID NO.1) was cloned from XZ16, and it was named HvALS1.

[0036] Total RNA was extracted from the roots of the annual wild barley XZ16 on the Qinghai-Tibet Plateau using the Total RNA Extraction Kit (Takara, Japan), and genomic DNA contamination in the total RNA was removed with DNaseI (Takara, Japan), and the reverse transcription kit was used with PrimeScripffM II 1stStrand cDNA Synthesis Kit ( Takara, Japan) reverse-transcribed the extr...

Embodiment 2

[0056] BSMV-VIGS method to verify the function of HvALS1 gene

[0057] 1. Construction of BSMV:HvALS1 vector

[0058] Use the total RNA extraction kit (Takara, Japan) to extract the total RNA of XZ16 roots, and use DNaseI (Takara, Japan) to remove genomic DNA contamination in the total RNA, and use PrimeScript TM Total RNA was reverse-transcribed into cDNA with II 1st Strand cDNASynthesis Kit reverse transcription kit (Takara, Japan). Primers were designed according to the Blast results, and a 262bp HvALS1 gene fragment was amplified.

[0059] KOD enzyme PCR reaction system:

[0060]

[0061] The amplification program was: 94°C for 5 min, (98°C for 10 s, 58°C for 30 s, 68°C for 30 s) 35 cycles, 68°C for 10 min.

[0062] The primer sequence is (the underline is the restriction site):

[0063] HvALS1-γ-F: 5'-GTAC GCTAGC CAAAACATGACGCCGGGAAG-3' (SEQ ID No: 10);

[0064] HvALS1-γ-R:5'-GTAC GCTAGC CGAGCAACGACTCTCTCACT-3' (SEQ ID No: 11).

[0065] Connect the HvALS1 gen...

Embodiment 3

[0083] HvALS1 gene overexpression

[0084] 1. Construction of overexpression vector

[0085] The method of constructing the overexpression vector in this experiment is Gateway. The total RNA of the barley variety Golden Promise was extracted, reverse-transcribed into cDNA, primers for the overexpression vector of the HvALS1 gene were designed, and the cDNA was used as a template to amplify the target gene. After sequence alignment, the CDS sequence of the Golden Promise HvALS1 gene is consistent with that of XZ16.

[0086] Wherein the overexpression primer of HvALS1 gene amplifies the target fragment primer sequence of 1935bp as follows:

[0087] AttB-F-Overexpression-HvALS1:GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGTGAGGGAGCTGCGC (SEQ ID No: 13);

[0088] AttB-R-Overexpression-HvALS1: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTGGCCATTACTGCTGG (SEQ ID No: 14).

[0089] Use 1% agarose gel electrophoresis to detect the position of the band of the PCR amplified product, perform gel recovery ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a barley HvALS1 gene and a use thereof in enhancing aluminum tolerance of barley, belonging to the technical field of genetic engineering. The nucleotide sequence of the CDS region of the barley HvALS1 gene is shown in SEQ ID NO. 1. The invention combines the cloning and analysis of barley HvALS1 gene with BSMV-Vigs gene silencing and Agrobacterium tumefaciens-mediated overexpression are used to verify the function of the gene. BSMV-VIGS-The results showed that HvALS1 gene is closely related to barley acid-aluminum tolerance, which provided theoretical basis and relatedgenes for barley acid-aluminum tolerance breeding and production.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to barley HvALS1 gene and its application in enhancing the aluminum tolerance of barley. Background technique [0002] Aluminum is the most abundant metal element in the earth's crust, accounting for about 8% (Mannello et al., 2011). In a neutral environment, aluminum in the soil mainly exists in the form of silicates or oxides, which are non-toxic to plants. However, when the pH of the external environment is less than 5.5, the aluminum in the compound state will gradually dissociate. ionic Al 3+ , and this ionic Al 3 + It is toxic to the growth of plants. Its most significant symptom of toxicity is to inhibit the elongation of plant roots, thereby inhibiting the absorption of water and nutrients by plants (Kochian, 1995), thereby affecting the growth and development of plants as a whole and reducing plant growth. Yield. Therefore, Al 3+ It is considered to be one...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8271
Inventor 刘文星邬飞波曹方彬冯雪戴华鑫张国平
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com