A low-endotoxin Escherichia coli prokaryotic expression engineering strain mutant and its construction method

A technology of Escherichia coli and prokaryotic expression, applied in the field of bioengineering, can solve the problems of reducing lipopolysaccharide endotoxin activity and restricting the application of recombinant proteins, etc., and achieve the effect of reducing pollution and broad market application prospects

Active Publication Date: 2017-02-15
SICHUAN AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Escherichia coli BL21 (DE3) and its derivatives are widely used for the expression of recombinant proteins due to their high efficiency, large yield and simple procedures. However, the residual lipopolysaccharide (LPS) in the purified recombinant protein is extremely Limits the application of recombinant proteins in humans and other mammals, so it is necessary to minimize the toxicity of lipopolysaccharide in expressing and purifying recombinant proteins
[0005] However, in the prior art, there has not been a method that can significantly reduce the endotoxin activity of lipopolysaccharide

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A low-endotoxin Escherichia coli prokaryotic expression engineering strain mutant and its construction method
  • A low-endotoxin Escherichia coli prokaryotic expression engineering strain mutant and its construction method
  • A low-endotoxin Escherichia coli prokaryotic expression engineering strain mutant and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1. ∆ wxya Primer design and PCR amplification

[0064] According to the reported Escherichia coli BL21 (DE3) sequence (refer to GenBank sequence number NC_012892), design two pairs of fusion PCR primers to amplify separately wxya The upstream homology arm and downstream homology arm of the gene have amplified fragment sizes of 450bp and 380bp respectively. The above primers were synthesized by Beijing Huada Gene Company. The primer sequences are as follows:

[0065] msbB left-up: 5'CAGTTCGACAATGTGGAAGAAG 3'

[0066] msbB left-down: 5’ ACCTGCAGGATGCGGCCGCGG GCCTCTCGCGAGG3’

[0067] msbB right-up: 5’ CCGCGGCCGCATCCTGCAGGT GCTTTTCCAGTTTCGG3’

[0068] msbB right-down: 5’ GCGTTATATGCACTTGCGC 3’

[0069] 2. Escherichia coli BL21 (DE3) wxya Amplification and fusion of the upper and lower homology arms of the gene

[0070] Inoculate the lyophilized Escherichia coli BL21 (DE3) strain into LB (ordinary broth) plate for overnight culture, pick a single colony and inoculat...

Embodiment 2

[0081] 1. ∆ pagP Primer design and PCR amplification

[0082] According to the reported Escherichia coli BL21 (DE3) sequence (refer to GenBank sequence number NC_012892), design two pairs of fusion PCR primers to amplify separately pagP The upstream homology arm and downstream homology arm of the gene have amplified fragment sizes of 350bp and 280bp respectively. The above primers were synthesized by Beijing Huada Gene Company. The primer sequences are as follows:

[0083] pagP left-up: 5’ CCTTGATTGCATTTTGTCAT 3’

[0084] pagP left-down: 5’ GTCTCACCCGGGCCTGCAGGTTGTGACCATAAAACATTTA 3’

[0085] pagP right-up: 5’ CACAACCTGCAGGCCCGGGTGAGACAAATGAAGTTTTAGT 3’

[0086] pagP right-down: 5’ TGCTGCCGTCTTCCGGAGTA 3’

[0087] 2. Escherichia coli BL21 (DE3) pagP Amplification and fusion of the upper and lower homology arms of the gene

[0088] Inoculate the lyophilized Escherichia coli BL21 (DE3) strain into LB (ordinary broth) plate for overnight culture, pick a single colony and...

Embodiment 3

[0099] 1. Construction of low-copy expression plasmids

[0100] Using the plasmid pYA4291 as a template, design primers to amplify the gene containing pagL and promoter P lpp A whole sequence of lpxRU-P lpp pag L -lpxRD, use the sequence to perform +A treatment, use the plus A reaction kit of Tiangen Biochemical, the reaction system is: template 15 μL, plus A buffer 4 μL, Taq enzyme 1 μL; the reaction conditions are: 72 ° C for 30 minutes, after the reaction is completed stand-by. The fragment needs to be connected to the T-terminal expression vector p15a, and at the same time use Ahd I The vector is digested with enzymes to make it have a T-terminus, and the two fragments are connected to obtain expression pag L low-copy plasmids.

[0101] Using the same strategy, using the plasmid pYA4295 as a template, amplified containing lpxE and promoter P lpp A whole segment of the sequence was ligated into p15a in the same way to obtain a low-copy plasmid expressing lpxE.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain and a construction method and belongs to the technical field of biological engineering. The low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain can achieve the purpose of reducing the toxicity of lipopolysaccharides by knocking out an msbB gene and a pagP gene for regulating and controlling synthesis of lipoid A fatty acid chains on a bacterial genome with suicide plasmids and a homologous recombination method to reduce the quantity of the lipoid A fatty acid chains and further achieve the purpose of reducing the activity of endotoxin of the strain by expressing pagL and lpxE proteins with exogenous low-copy expression plasmids to simultaneously remove the fatty acid chains and phosphate groups of lipoid A. The lipopolysaccharides produced by the low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain Escherichia coli BL21(DE3)S004 constructed by using the technology, with collection number of CCTCCNO. M2014473 and collection time of October 14, 2014, can stimulate cells to show an obvious effect of reducing the activity of the endotoxin, thereby laying a foundation for subsequent exogenous proteins and targeting medicines using the expression of the engineering bacteria for treatment.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a low-endotoxin Escherichia coli prokaryotic expression engineering strain mutant and a construction method. Background technique [0002] Lipopolysaccharide is a structural component that exists in large quantities in the cell membrane of Gram-negative bacteria. It is composed of hydrophobic lipid A, short-chain non-repeating core polysaccharides and long-chain O-antigen polysaccharides. The active ingredient lipid A will activate The TLR4 / MD2 / CD14 pathway in the body stimulates the secretion of cytokines such as tumor necrosis factor and interleukin-6, which leads to an immune inflammatory response. Excessive immune inflammatory response can cause tissue damage, shock and even death in the body. [0003] Lipid A of Escherichia coli includes two phosphate groups and six fatty acid chains. This structure can most effectively stimulate the body to produce immune and inflammat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12R1/19
CPCC12N9/1029C12N9/12C12N9/80C12N9/93
Inventor孔庆科刘琼刘青赵新新
OwnerSICHUAN AGRI UNIV