A kind of alginate lyase sha-3 gene and its prokaryotic expression vector
An alginate lyase and prokaryotic expression technology, which is applied in the field of microbial genetic engineering, can solve the problems of high cost, difficult to meet application requirements, low enzyme production by wild-type alginate decomposing bacteria, etc., and achieves easy operation and wide substrates. The effect of specificity and ease of industrial production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Marinicatena alginatilytica Preparation and Detection of SH-52 Genomic DNA
[0040] used in the present invention Marinicatena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. Add 100ul Solution I suspension bacteria, 30ul 10% SDS and 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65℃, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12000rpm for 5 minutes; take the supernatant, add 2 times the volume of Water and ethanol, 0.1 times the volume of 3mol / L NaOAC, placed at -20°C for 30 minutes; centrifuged at 12,000 ...
Embodiment 2
[0041] Example 2: Alginate Lyase SHA-3 Gene amplification and TA cloning
[0042] alginate lyase SHA-3 gene amplification and cloning figure 2 As shown, first find out from the whole genome sequencing results SHA-3 The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:
[0043] SHA-3-F: GGATCC ATGATGACCAAAAACATTAGTG
[0044] SHA-3-R: GCGGCCGC TTAATACATCAGCTTCAACTCAAT
[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.
[0046] Add 10 ng of Marinicatena alginatilytica SH-52 genomic DNA is used as a template, and 50ng of specific primers SHA-3-F and SHA-3-R, 2.5μl dNTP (10mM), 2.5μl of Pfu reaction buffer and 0.5μl of pfu (5U / ul) are added at the same time Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25 μl. Heated a...
Embodiment 3
[0047] Example 3: Prokaryotic expression vector pGEX-4T-1- SHA-3 build
[0048] pGEX-4T-1- SHA-3 A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19T- SHA-3 , separated the cut vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19T- SHA-3 produced by cutting SHA-3 The DNA fragment of the gene (about 2.3kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-3 The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-3 . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate added with ampicillin (Amp, 100mg / L). Cultivate overnight at 37°C, screen Amp-resistant recombinant colonies, and extract plasmids from Amp-resistant...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap