Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of alginate lyase sha-3 gene and its prokaryotic expression vector

An alginate lyase and prokaryotic expression technology, which is applied in the field of microbial genetic engineering, can solve the problems of high cost, difficult to meet application requirements, low enzyme production by wild-type alginate decomposing bacteria, etc., and achieves easy operation and wide substrates. The effect of specificity and ease of industrial production

Active Publication Date: 2018-07-24
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type alginate-decomposing bacteria have low enzyme production and high cost, and it is difficult to meet the actual application requirements.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of alginate lyase sha-3 gene and its prokaryotic expression vector
  • A kind of alginate lyase sha-3 gene and its prokaryotic expression vector
  • A kind of alginate lyase sha-3 gene and its prokaryotic expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Marinicatena alginatilytica Preparation and Detection of SH-52 Genomic DNA

[0040] used in the present invention Marinicatena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. Add 100ul Solution I suspension bacteria, 30ul 10% SDS and 1ul 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour; add 100ul 15mol / L NaCl, mix well; add 20ul CTAB / NaCl solution (CTAB 10%, NaCl 0.7mol / L), mix well, 65℃, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to mix, centrifuge at 12000rpm for 5 minutes; take the supernatant, add 2 times the volume of Water and ethanol, 0.1 times the volume of 3mol / L NaOAC, placed at -20°C for 30 minutes; centrifuged at 12,000 ...

Embodiment 2

[0041] Example 2: Alginate Lyase SHA-3 Gene amplification and TA cloning

[0042] alginate lyase SHA-3 gene amplification and cloning figure 2 As shown, first find out from the whole genome sequencing results SHA-3 The full-length gene sequence, and design a pair of specific primers, the sequence is as follows:

[0043] SHA-3-F: GGATCC ATGATGACCAAAAACATTAGTG

[0044] SHA-3-R: GCGGCCGC TTAATACATCAGCTTCAACTCAAT

[0045] The 5' end primer has the GGATCC characteristic sequence, and thus forms the BamH I restriction site; the 3' end adds the GCGGCC characteristic sequence, forming the Not I restriction site.

[0046] Add 10 ng of Marinicatena alginatilytica SH-52 genomic DNA is used as a template, and 50ng of specific primers SHA-3-F and SHA-3-R, 2.5μl dNTP (10mM), 2.5μl of Pfu reaction buffer and 0.5μl of pfu (5U / ul) are added at the same time Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25 μl. Heated a...

Embodiment 3

[0047] Example 3: Prokaryotic expression vector pGEX-4T-1- SHA-3 build

[0048] pGEX-4T-1- SHA-3 A build strategy such as Figure 6 As shown, the purified prokaryotic expression vectors pGEX-4T-1 (purchased from GE Healthcare) and pMD19T- SHA-3 , separated the cut vector and insert fragments by agarose gel electrophoresis, and recovered the vector fragments pGEX-4T-1 (4.9kb) and pMD19T- SHA-3 produced by cutting SHA-3 The DNA fragment of the gene (about 2.3kb), and then use the ligase kit of TaKaRa to connect the pGEX-4T-1 vector fragment and SHA-3 The DNA fragment of the gene produces the prokaryotic expression vector pGEX-4T-1- SHA-3 . Use the ligation reaction mixture to transform high-efficiency E. coli competent cells Trans1-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and spread the transformed E. coli on a plate added with ampicillin (Amp, 100mg / L). Cultivate overnight at 37°C, screen Amp-resistant recombinant colonies, and extract plasmids from Amp-resistant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alginate lyase SHA‑3 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The invention constructs a prokaryotic expression vector of the alginate lyase SHA‑3 gene, which can be used in The expression product alginate lyase SHA‑3 was obtained in a short period of time, and it has a wide range of substrate specificity. It can use both polymannuronic acid PolyM and polyguluronic acid PolyG as substrates, and the enzyme activity reaches 12U / mg, is a bifunctional enzyme with broad application prospects, the prokaryotic expression vector and the overall expression system of the present invention are easy to operate, and are convenient for industrial production.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to an alginate lyase SHA-3 gene and its prokaryotic expression vector pGEX-4T-1- SHA-3 , the vector highly expresses the alginate lyase protein SHA-3. Background technique [0002] In recent years, the development and utilization of marine resources has gradually become a research hotspot. Because of its unique physical and chemical properties, alginic acid has broad application prospects in the fields of food, medicine and chemical industry. Alginate oligosaccharides have become the focus of new drug development because of their various physiological activities. At the same time, as one of the most abundant marine biomass, alginic acid has the following advantages: (1) high photosynthetic efficiency, fast growth, high yield, and abundant resources; (2) growth does not occupy arable land; (3) hardly contains wood The content of cellulose is very small, the pretreatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/60C12N15/70
Inventor 伊日布斯何漫漫李曙梅严金平
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com