A kind of alginate lyase sha-6 gene and its application

A technology of alginate lyase and SHA-6, which is applied in the field of microbial genetic engineering and can solve the problems of low expression level and unreported issues

Active Publication Date: 2020-12-15
KUNMING UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] from the strain Marinicatena alginatilytica Five kinds of alginate lyases have been found in SH-52. These enzymes were expressed heterologously and isolated from the supernatant after the bacteria were crushed and centrifuged. The expression levels of these enzymes were low after gene induction, and after analysis The enzyme gene has only one structural domain, so far no heterologous expression alginate lyase has been found in the precipitate after centrifugation, and there have been no reports about this type of enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of alginate lyase sha-6 gene and its application
  • A kind of alginate lyase sha-6 gene and its application
  • A kind of alginate lyase sha-6 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Marina catena alginatilytica Preparation and Detection of SH-52 Genomic DNA

[0040] used in the present invention Marina catena alginatilytica SH-52 is a strain screened by our laboratory. The preparation of SH-52 genomic DNA adopts the extraction method of common bacterial genome. The specific content is as follows: Take 2 mL of overnight culture liquid and centrifuge at 4000 rpm for 2 min at 4 ° C. Discard the supernatant and collect the bacteria. To the body, add 100 µL Solution I suspension, 30 µL 10% SDS and 1 µL 20 mg / mL proteinase K, mix well, and incubate at 37°C for 1 h. Add 100 µL of 5M NaCl, invert and mix well, then add 20 µL CTAB / NaCl solution (CTAB 10%, 0.7M NaCl), and incubate at 65°C for 10 min. Add an equal volume of chloroform / isoamyl alcohol (24:1), mix by inverting, and centrifuge at 12,000 rpm for 5 min at 4°C. Take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3M NaAc, place at -20°C for 30 m...

Embodiment 2

[0041] Embodiment 2: the amplification and TA clone of alginate lyase SHA-6 gene

[0042] alginate lyase SHA-6 gene amplification and cloning figure 2 As shown, design a pair of specific primers, the sequence is as follows:

[0043] SHA-6-F : GGATCC ATGCAGAAAAAGTATGTCTCGCT

[0044] SHA-6-R: GCGGCCGC TTAATGAATGATTAATTTGTAG

[0045] The GGATCC characteristic sequence was introduced at the 5' end to form a BamH I restriction site; the GCGGCC characteristic sequence was introduced at the 3' end to form a Not I restriction site.

[0046] Add 10 ng of Marinicatena alginatilytica SH-52 genomic DNA was used as a template, and 50ng of specific primers SHA-6-F and SHA-6-R, 2.5µL of dNTP (10mM), 2.5µL of Pfu reaction buffer and 0.5µL of Pfu (5U / µL) were added to aggregate Enzyme (Beijing Quanshijin Biotechnology Co., Ltd.), add double distilled water to make the final volume 25µL. Heat at 94°C for 3 minutes on the PCR instrument, then perform 25 cycles of reaction according ...

Embodiment 3

[0047] Example 3: Prokaryotic expression vector pET-32a- SHA-6 build

[0048] Such as Figure 4 As shown, the purified prokaryotic expression vectors pET-32a and pMD19-T- SHA-6 , the cut vector and the inserted target fragment were separated by agarose gel electrophoresis, and the vector fragments pET-32a and pMD19-T- SHA-6 produced by cutting SHA-6 The DNA fragment was connected to the pET-32a vector fragment and SHA-6 Prokaryotic expression vector pET-32a- SHA- 6 . Transform the ligation reaction mixture into Escherichia coli competent cells BL21 (Tiangen Biochemical Technology), spread the transformed Escherichia coli on a plate added with ampicillin (final concentration: 100 µg / mL), culture overnight at 37°C, and select Amp Resistant recombinant colonies, using SHA-6-F and SHA-6-R primers for colony PCR verification, after the successful connection of the plasmids for liquid culture, the plasmid DNA was extracted by alkaline lysis, and the recombinant plasmid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alginate lyase SHA-6 gene with a nucleotide sequence as shown in SEQ ID NO:1; the alginate lyase SHA-6 gene is recombined with pET-32a(+) plasmids for being converted into escherichia coli BL21 to obtain engineering bacteria of alginate lyase SHA-6; the bacterial strain is induced to express to generate a great number of inclusion body proteins SHA-6; the alginate lyaseSHA-6 inclusion body is subjected to protein purifying and renaturation, so that the inclusion body recovers activity; the re-natured alginate lyase has wide substrate specificity, polymannose aldehyde acid PolyM and polygulose aldehyde acid PolyG can be utilized as a substrate, and enzyme activity reaches 13.5U / mg, so that the alginate lyase SHA-6 gene is alginate lyase with a wide application prospect.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to the alginate lyase SHA-6 gene and its engineering strain and its application in preparing the alginate lyase. Background technique [0002] Alginic acid is produced by brown algae and limited Gram-negative bacteria. They consist of randomly distributed homopolymeric blocks of poly-β-(1→4)-D-mannuronic acid and poly-α-(1→4)-L-guluronic acid and a random arrangement of the two monomers The heteropolymer blocks formed. Due to its viscous and gel properties, alginic acid is widely used in the food and pharmaceutical industries. Recently, the application of alginic acid in bioethanol production has received continuous attention. [0003] Alginic acid is a natural polymer compound that can be degraded by a series of methods. Currently, there are generally three methods for degrading alginic acid: chemical degradation, physical degradation and biological degr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/60C12N1/21C12N9/88C12R1/19
CPCC12N9/88
Inventor伊日布斯陈可可王康严金平
OwnerKUNMING UNIV OF SCI & TECH