Anti-CTLA-4 and PD-1 dual variable domain immunoglobulin
A technology of CTLA-4 and PD-1, which is applied in the direction of hybrid immunoglobulins, antibodies, anti-tumor drugs, etc., and can solve problems such as statistical differences
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1, anti-CTLA-4 antibody and anti-PD-1 antibody sequence
[0038] Anti-CTLA-4:
[0039]
[0040]
[0041] Anti-PD-1 antibody sequence:
[0042]
[0043]
[0044]
Embodiment 2
[0045] Example 2, Synthesis of Ipi(out)-L-Niv(in)DVD-Ig Bispecific Antibody BY18.1 Gene and Construction of Expression Vector
[0046] 1) Based on the sequence of the CTLA-4 antibody Ipilimumab and the sequence of the anti-PD-1 antibody Nivolumab. Sequence commissioned Shanghai Jierui Bioengineering Co., Ltd. to synthesize the Ipi-L(out)-Niv-L(in)DVD-Ig bispecific antibody light chain (L chain) coding gene, and optimized the coding gene to be suitable for Coding gene expressed by CHO cells. Ligated to the p327.7 expression vector (patent application number: 201410441296.0) by XhoI-EcoRI double digestion. Named BY18.1L.
[0047] CTCGAGCCACC GAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATCGTGCTGACACAGTCCCCTGGCACCCTGTCTCTGTCCCCAGGCGAGCGCGCCACCCTGTCTTGCCGCGCCTCTCAGAGCGTGGGCTCCTCTTACCTCGCTTGGTATCAGCAGAAGCCCGGCCAGGCTCCAAGACTCCTCATCTACGGCGCTTTCAGTCGGGCTACAGGCATTCCCGACCGGTTCAGCGGCAGCGGCTCCGGCACAGACTTCACCCTCACTATTTCGCGCCTCGAACCCGAGGACTTCGCCGTGTACTACTGCCAGCAGTACGGCTCTA...
Embodiment 3
[0057] Example 3, Synthesis of Niv(out)-L-Ipi(in)DVD-Ig bispecific antibody BY18.2 gene and construction of expression vector
[0058] 1) Similarly, based on the sequence of the CTLA-4 antibody Ipilimumab and the sequence of the anti-PD-1 antibody Nivolumab. Entrusted Shanghai Jierui Bioengineering Co., Ltd. to synthesize the Niv-L(out)-L-Ipi-L(in)DVD-Ig bispecific antibody light chain (L chain) coding gene, and optimize the coding gene to a suitable Coding gene expressed in CHO cells. Ligated to the p327.7 expression vector (patent application number: 201410441296.0) by XhoI-EcoRI double digestion. Named BY18.2L.
[0059] CTCGAGCCACC GAGACCGACACACTCCTCCTGTGGGTGCTGCTGCTGTGGGTGCCTGGCTCCACTGGCGAGATTGTGCTGACACAGTCCCCCGCTACTCTGAGCCTGAGCCCTGGCGAGAGGGCTACACTGTCTTGCAGAGCTTCTCAGTCCGTGTCTTCTTACCTCGCTTGGTATCAGCAGAAGCCCGGCCAGGCTCCAAGACTGCTGATCTATGACGCTTCTAACCGCGCTACAGGCATTCCTGCTAGGTTCAGCGGCAGCGGCTCTGGCACCGACTTCACACTCACAATTAGCTCTCTTGAACCTGAGGACTTCGCCGTGTACTACTGCCAGCAGTCTAGCAACTGGCCTAG...
PUM
Property | Measurement | Unit |
---|---|---|
Theoretical molecular weight | aaaaa | aaaaa |
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com