Supercharge Your Innovation With Domain-Expert AI Agents!

5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of gene

A technology of enolacetone shikiki and phosphate synthase, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as research reports on enzyme functions that have not been seen, and achieve strong affinity and high glyphosate resistance sexual effect

Inactive Publication Date: 2015-11-25
SHANGHAI ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the 5-enolpyruvylshikimate-3-phosphate synthase from this bacterium has never been studied, and there is no research report on the function of the enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of gene
  • 5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of gene
  • 5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Synthesis of 5-enolpyruvylshikimate-3-phosphate synthase gene derived from Thermotoga maritima by gene synthesis

[0029] According to the source from Thermotoga maritima aroA Sequence (NCBIReferenceSequence: NC_000853.1) adopts continuous extension PCR (Nucleic Acids Research, 2004, 32, e98) to synthesize 5-enolpyruvylshikimate-3-phosphate synthase gene according to plant codon preference, and designs 33 pairs of primers for 5 - Artificial synthesis of enolpyruvylshikimate-3-phosphate synthase gene. The designed primers are as follows:

[0030] aroA-Tm -1:

[0031] GGATCCATGAAGGTTCTTCCTGCTAAGAAGGTTGAAGGTGTTCTTTCTGTTCCACCTGAC

[0032] aroA-Tm -2:

[0033] AGAGCAGACAGGATCAGTGCTCTGTGAGTGATAGACTTGTCAGGTGGAACAGAAAGAACA

[0034] aroA-Tm -3:

[0035] GAGCACTGATCCTGTCTGCTCTGGCTGAGACCGAGTCCACTCTCTACAACCTGTTGAGAT

[0036] aroA-Tm -4:

[0037] CTTCTCCAGGATGTCGTGGGTTCTCTCGGTGTCCAGACATCTCAACAGGTTGTAGAGAGT

[0038] aroA-Tm -5:

[0039] AACCCACGACATCCTGGAG...

Embodiment 25

[0101] Escherichia coli Expression of Example 25-Enolpyruvyl Shikimate-3-Phosphate Synthetase Gene

[0102] The 5-enolpyruvylshikimate-3-phosphate synthase gene synthesized in Example 1 was used Bam H I and Sac After I digestion, it was connected with the vector pET-28a (NEB Company) to obtain the recombinant plasmid pET-p aroA T.maritima , and transform it into Escherichia coli BL21 (DE3) (Novagen Company), spread the transformants on LB solid medium and culture at 37°C for 16h. The gel-protein purification kit HisTrapHP (Amersham Biosciences) was used for protein expression and purification, and SDS-PAGE electrophoresis detection. Detected by SDS-PAGE electrophoresis, the protein size is about 46.5kDa, consistent with the predicted value (see figure 1 ).

Embodiment 35

[0103] Example 35- Determination of Enzyme Activity and Kinetic Parameters of Enolpyruvyl Shikimate-3-Phosphate Synthetase Gene

[0104] 1. Measurement method

[0105] Inorganic phosphorus standard curve: Dilute 10mM inorganic phosphorus at 1:10, take 0, 1, 2, 3...20μl and 1.5ml Eppendorf centrifuge tube respectively, add pure water to 100μl and mix well, add 0.8ml MAT solution and mix well, time After three minutes, add 100 μl of SC solution and mix quickly, and measure A after standing at room temperature for 20 minutes. 660 value, repeated three times. Taking the concentration of inorganic phosphorus as the abscissa, A 660 Values ​​were plotted on the ordinate to obtain a standard curve for inorganic phosphorus.

[0106] 1) Determination of enzyme activity: Coomassie brilliant blue G-250 staining method was used for protein quantification. Add the following solutions to a 1.5ml Eppendorf centrifuge tube on ice: 2μl of 10mMPEP solution, 2μl of 10mMS3P solution, 2μl of 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a 5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of the gene. The nucleotide sequence of the 5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima (aroA-Tm) is as shown in SEQ ID NO. 1 and is 1266bp in total length, and the coded protein sequence is as shown in SEQ ID NO. 2. The aroA-Tm gene is prepared by virtue of a gene synthesis method. Analysis on enzymatic kinetic characteristics and a function test verify that the synthesized 5-enolpyruvylshikimate-3-phosphate synthase gene is relatively high in glyphosate tolerance, and is applicable to the breeding of transgenic crops.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a 5-enolpyruvylshikimate-3-phosphate synthase gene derived from Thermotoga maritima and its application. Background technique [0002] Glyphosate is an excellent broad-spectrum sterilizing and systemic herbicide, widely used in orchards, rubber gardens, non-cultivated land, and no-till land for pre-sowing or post-sowing treatment of corn, soybeans, and cotton, as well as post-emergence orientation deal with. Since it was registered in the United States in 1974, it has been registered in more than 100 countries around the world, becoming one of the most widely used herbicides in the world. But the herbicide is also a non-selective herbicide, which also has a killing effect on crops. In order to use glyphosate in agricultural production, crops must be bred to be glyphosate-resistant or degradable. [0003] The toxic mechanism of glyphosate (N-phosphonomet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/10C12R1/01
Inventor 王丽娟姚泉洪彭日荷
Owner SHANGHAI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More