5-enolpyruvylshikimate-3-phosphate synthase gene derived from thermotoga maritima and application of gene
A technology of enolacetone shikiki and phosphate synthase, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as research reports on enzyme functions that have not been seen, and achieve strong affinity and high glyphosate resistance sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Synthesis of 5-enolpyruvylshikimate-3-phosphate synthase gene derived from Thermotoga maritima by gene synthesis
[0029] According to the source from Thermotoga maritima aroA Sequence (NCBIReferenceSequence: NC_000853.1) adopts continuous extension PCR (Nucleic Acids Research, 2004, 32, e98) to synthesize 5-enolpyruvylshikimate-3-phosphate synthase gene according to plant codon preference, and designs 33 pairs of primers for 5 - Artificial synthesis of enolpyruvylshikimate-3-phosphate synthase gene. The designed primers are as follows:
[0030] aroA-Tm -1:
[0031] GGATCCATGAAGGTTCTTCCTGCTAAGAAGGTTGAAGGTGTTCTTTCTGTTCCACCTGAC
[0032] aroA-Tm -2:
[0033] AGAGCAGACAGGATCAGTGCTCTGTGAGTGATAGACTTGTCAGGTGGAACAGAAAGAACA
[0034] aroA-Tm -3:
[0035] GAGCACTGATCCTGTCTGCTCTGGCTGAGACCGAGTCCACTCTCTACAACCTGTTGAGAT
[0036] aroA-Tm -4:
[0037] CTTCTCCAGGATGTCGTGGGTTCTCTCGGTGTCCAGACATCTCAACAGGTTGTAGAGAGT
[0038] aroA-Tm -5:
[0039] AACCCACGACATCCTGGAG...
Embodiment 25
[0101] Escherichia coli Expression of Example 25-Enolpyruvyl Shikimate-3-Phosphate Synthetase Gene
[0102] The 5-enolpyruvylshikimate-3-phosphate synthase gene synthesized in Example 1 was used Bam H I and Sac After I digestion, it was connected with the vector pET-28a (NEB Company) to obtain the recombinant plasmid pET-p aroA T.maritima , and transform it into Escherichia coli BL21 (DE3) (Novagen Company), spread the transformants on LB solid medium and culture at 37°C for 16h. The gel-protein purification kit HisTrapHP (Amersham Biosciences) was used for protein expression and purification, and SDS-PAGE electrophoresis detection. Detected by SDS-PAGE electrophoresis, the protein size is about 46.5kDa, consistent with the predicted value (see figure 1 ).
Embodiment 35
[0103] Example 35- Determination of Enzyme Activity and Kinetic Parameters of Enolpyruvyl Shikimate-3-Phosphate Synthetase Gene
[0104] 1. Measurement method
[0105] Inorganic phosphorus standard curve: Dilute 10mM inorganic phosphorus at 1:10, take 0, 1, 2, 3...20μl and 1.5ml Eppendorf centrifuge tube respectively, add pure water to 100μl and mix well, add 0.8ml MAT solution and mix well, time After three minutes, add 100 μl of SC solution and mix quickly, and measure A after standing at room temperature for 20 minutes. 660 value, repeated three times. Taking the concentration of inorganic phosphorus as the abscissa, A 660 Values were plotted on the ordinate to obtain a standard curve for inorganic phosphorus.
[0106] 1) Determination of enzyme activity: Coomassie brilliant blue G-250 staining method was used for protein quantification. Add the following solutions to a 1.5ml Eppendorf centrifuge tube on ice: 2μl of 10mMPEP solution, 2μl of 10mMS3P solution, 2μl of 0....
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com