A method and application for regulating mitochondrial gene expression using small RNA

A gene expression and mitochondrial technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, cells modified by introducing foreign genetic material, etc., can solve the problems that miRNA is impossible, impossible to regulate mitochondrial genes, etc., and achieve enhanced expression and translation level Effect

Active Publication Date: 2018-05-11
WUHAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The function of miRNA and siRNA in mitochondria has never been reported, because mitochondria is an organelle with a double membrane and has its own genetic system. Although miRNAs have been reported to exist in mitochondria, it is generally believed that miRNAs cannot present in mitochondria, and less likely to regulate expression of mitochondrial genes in mitochondria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and application for regulating mitochondrial gene expression using small RNA
  • A method and application for regulating mitochondrial gene expression using small RNA
  • A method and application for regulating mitochondrial gene expression using small RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Design of siRNA against mouse mitochondrial ND1 gene.

[0026] ND1 siRNA: UUCCUAUGGAUCCGAGCAUCTT, GAUGCUCGGAUCCAUAGGAATT.

[0027] (1) Culture 1×10 6 Mouse embryonic fibroblasts (MEFs) (25 cm2 growth area) were grown to 95% density.

[0028] (2) Prepare ND1 siRNA and control RNA (CtlRNA) (Shanghai Gemma Control RNA) transfection mixture according to the instructions of lipofectamin RNAimax (liposome), mix well and let stand for 20 minutes.

[0029] (3) Digest MEF cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, and add the transfection mixture in step (2). The transfected cells were placed in a 37°C carbon dioxide cell incubator and cultured continuously for 48 hours.

[0030] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.

[0031] The reverse transcription reaction conditions were standardized...

Embodiment 2

[0039] Effects of transfection of miR-1 (UGGAAUGUAAAAGAAGUAUGUAU) in human cervical cancer cells on mitochondrial genes

[0040] (1) Culture 1×10 6 Human cervical cancer cells (HeLa) (growth area of ​​25 cm2) were grown to 100% density.

[0041] (2) According to the instructions of lipofectamin 2000 (liposome), prepare miR-1 (the sequence of miR-1 was synthesized and purified at Takara Company as shown above) or control RNA (Ctl RNA) transfection mixture, mix well and let stand for 20 minute.

[0042](3) Digest HeLa cells with trypsin, spread the digested cells on a 24-well plate at a density of 30%, add the transfection mixture in step (2), and place the transfected cells in a 37°C carbon dioxide cell incubator for continuous Incubate for 48 hours.

[0043] (4) Wash the cells twice with PBS (pH 7.4), then treat the cells with Trizol (Life Technologies) reagent for 5 minutes, extract RNA, and perform reverse transcription quantitative PCR.

[0044] The reverse transcriptio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and application of small RNA regulating mitochondrial gene expression. Regulation of mitochondrial gene expression can be achieved by transfecting siRNA or miRNA into cells. This method can be used to study the function of mitochondrial genes and regulate mitochondrial function. Transferring siRNA of mitochondrial target genes into cells can effectively reduce the abundance of target gene mRNA in mitochondria, and also reduce the expression of protein level. miRNA can enhance the expression and translation level of target genes and regulate the function of mitochondria without changing the mRNA level of target genes in mitochondria. The invention discovers for the first time the regulating effect of small RNA on mitochondrial genes, and provides a new direction for studying the functions of mitochondrial genes.

Description

technical field [0001] The technology relates to molecular biology, cell biology and biochemistry, and specifically relates to a method and application of using small RNA to regulate mitochondrial gene expression. Background technique [0002] Mitochondria in eukaryotes is a semi-autonomous organelle with its own unique genetic system, the mitochondrial double-stranded closed circular DNA, and DNA replication, transcription, and protein translation systems. Mitochondrial gene replication, transcription and translation have been studied for 35 years. Although some progress has been made in the field, understanding of mitochondrial inheritance and gene expression is only the tip of the iceberg. [0003] In addition, it is quite difficult to understand the function of specific genes in mitochondria, because mitochondria are organelles with a double-membrane structure, and the outer and inner membranes of mitochondria are highly selective for the exchange of molecules within the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N5/10
Inventor张晓荣付向东
OwnerWUHAN UNIV