Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA bar code standard gene used for identifying culex modestus and applications

A standard gene and barcode technology, used in recombinant DNA technology, DNA/RNA fragments, and microorganism determination/inspection, etc., can solve the problems of incomplete samples, lengthened customs clearance period, low accuracy of morphological classification methods, etc. Accuracy, the effect of promoting quality improvement

Inactive Publication Date: 2016-03-23
宋锋林 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is mainly aimed at the adult stage, and is limited to vectors of other developmental stages (larvae, pupae, etc.) captured in the actual work of sanitation supervision; for the identification of vectors of closely related species similar to Culex pupae in appearance, the morphology The accuracy of the classification method is low
In the actual work of inspection and quarantine, non-adult insects such as larvae, eggs, and pupae are often intercepted. Usually, they need to be cultivated into adults before identification. The entire quarantine identification process takes several weeks, and often collected Incomplete samples, morphological methods encounter many difficulties in the identification of incomplete samples, which greatly lengthens the customs clearance period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA bar code standard gene used for identifying culex modestus and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0031] A DNA barcode standard gene used to identify Culex micropisciatus, the nucleotide sequence (635bp) of the gene is as follows:

[0032]GTTGATATAAAATTGGGTCTCCTCCTCCGATTGGGTCAAAGAATGAAGTATTTAAATTCCGATCAGTTAATAATATAGTAATAGCTCCAGCTAATACGGGTAAAGAAAGAAGTAATAAAACAGCAGTAATTACTACTGATCAAACAAATAATGGTATTCGATCAAGTGTAATTCCTGAAGATCGTATATTAATTACTGTTGTAATAAAATTTACTGCTCCTAAAATTGATGAAATCCCTGCTAAATGTAGAGAAAAAATAGCTAAATCAACTGATGCTCCAGCATGAGCAGTTCCGGATGAAAGAGGGGGATAAACTGTTCATCCAGTCCCAGCTCCATTTTCTACTATACTACTTGAAAGTAGAAGGGTTAATGAAGGAGGTAGTATTCAAAAACTTATATTATTTATTCGGGGAAATGCTATATCTGGGGCTCCTAACATTAAAGGAACTAATCAGTTTCCAAATCCTCCAATTATAATTGGTATTACTATAAAAAAAATTATAATAAATGCATGTGCAGTTACAATAACATTATAAATTTGATCATTTCCAATAAATACTCCAGGTTGACTTAATTCAGCTCGAATAAGTAAACTTAAAGAAGTACCTACTATCCAGCTCAAGCTCCGAAAA。

[0033] The molecular biology identification method for identifying Culex micropisciatus using the DNA barcode standard gene for identifying Culex micropisces comprises the following steps:

[0034] (1) Extract th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnology field, and especially relates to a DNA bar code standard gene used for identifying culex modestus and applications. The nucleotide sequence of the DNA bar code standard gene used for identifying culex modestus is shown in the ID No.1 in a sequence table. The provided DNA bar code standard gene can be applied to identification whether a specimen to be detected is culex modestus. The DNA bar code standard gene is suitable for practical needs of border port health quarantine work, and a relatively stable and accurate molecule identification method is established by utilization of the DNA bar code technology and aimed to culex modestus. Defected samples can be identified, culex modestus and sibling species can be distinguished and identified well, and the non-imago phase of culex modestus can be identified accurately. The provided DNA bar code standard gene has important promoting effects on raising accuracy of culex modestus classification identification and promoting health supervision work quality improvement.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a DNA barcode standard gene for identifying Culex minor and its application. Background technique [0002] At present, the classification and identification of vector organisms at home and abroad mainly rely on traditional morphological classification methods. This method is mainly aimed at the adult stage, and is limited to vectors of other developmental stages (larvae, pupae, etc.) captured in the actual work of health supervision; for the identification of closely related species of vectors with similar external shapes, the accuracy of the morphological classification method In addition, incomplete samples are often collected in practical work, and morphological methods encounter many difficulties in the identification of incomplete samples. In the port quarantine work, if the intercepted larvae, eggs, pupae and other non-adult worms, it is usually necessary to cultiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2600/124C12Q2563/185C12Q2565/125
Inventor 宋锋林程晓兰靳木子姜陆高玉峰万雪
Owner 宋锋林
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products