Supercharge Your Innovation With Domain-Expert AI Agents!

DNA bar code standard gene used for identifying aedes dorsalis and applications thereof

A technology of Aedes dorsi and standard genes, which is applied in the identification of Aedes dorsi's DNA barcode standard genes and its application fields, can solve the problems of prolonged customs clearance period, incomplete samples, and low accuracy of morphological classification methods, and promote The effect of improving quality and improving accuracy

Inactive Publication Date: 2016-03-23
宋锋林 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is mainly aimed at the adult stage, and is limited to vectors of other developmental stages (larvae, pupae, etc.) captured in the actual work of health supervision; for the identification of vectors of related species similar to Aedes dorsalis in appearance, the morphology The accuracy of the classification method is low
In the actual work of inspection and quarantine, non-adult insects such as larvae, eggs, and pupae are often intercepted. Usually, they need to be cultivated into adults before identification. The entire quarantine identification process takes several weeks, and often collected Incomplete samples, morphological methods encounter many difficulties in the identification of incomplete samples, which greatly lengthens the customs clearance period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA bar code standard gene used for identifying aedes dorsalis and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0031]A DNA barcode standard gene used to identify Aedes dorsopoint, the nucleotide sequence (679bp) of the gene is as follows:

[0032] ATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTATATTCATTGGAAATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTAACACTACTACTTTCAAGTAGTATAGTAGAAAATGGGTCAGGAACAGGGTGAACAGTTTATCCACCTCTTTCTTCTGGAACTGCTCATGCAGGAGCTTCAGTTGATTTAACAATTTTTTCTTTACATTTAGCTGGAGTATCATCAATTTTAGGAGCAGTAAATTTTATTACTACTGTTATTAATATACGATCAGCAGGAATTACTTTAGATCGATTACCTTTATTTGTTTGATCTGTTGTAATTACAGCAGTATTATTACTTTTATCATTGCCTGTTTTAGCTGGAGCTATTACTATGTTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTATTGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCTGGAAAGTTTAAA。

[0033] The molecular biology identification method for identifying Aedes dorsi using the DNA barcode standard gene for identifying Aedes dorsi comprises the following steps:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnology field, and especially relates to a DNA bar code standard gene used for identifying aedes dorsalis and applications thereof. The nucleotide sequence of the provided DNA bar code standard gene is shown in ID No.1 in a sequence table. The provided DNA bar code standard gene can be applied to identification whether a to-be-tested specimen is aedes dorsalis. The provided DNA bar code standard gene meets practical needs of frontier port health and quarantine work, and by utilization of the DNA bar code technology and aimed to aedes dorsalis, a relatively stable and accurate molecule identification method is established. Defected samples can be identified, aedes dorsalis and sibling species can be distinguished and identified well, and the aedes dorsalis non-imago phase can be identified accurately. The provided DNA bar code standard gene has important promoting effects on raising accuracy of aedes dorsalis classification and identification and improving quality of health supervision work.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a DNA barcode standard gene for identifying Aedes dorsalis and its application. Background technique [0002] At present, the classification and identification of vector organisms at home and abroad mainly rely on traditional morphological classification methods. This method is mainly aimed at the adult stage, and is limited to vectors of other developmental stages (larvae, pupae, etc.) captured in the actual work of health supervision; for the identification of closely related species of vectors with similar external shapes, the accuracy of the morphological classification method In addition, incomplete samples are often collected in practical work, and morphological methods encounter many difficulties in the identification of incomplete samples. In the port quarantine work, if the intercepted larvae, eggs, pupae and other non-adult worms, it is usually necessary to cultivate them ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q1/686C12Q2600/124C12Q2563/185C12Q2565/125
Inventor 程晓兰宋锋林王金玲姜陆高玉峰万雪
Owner 宋锋林
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More