DNA bar code standard gene used for identifying aedes dorsalis and applications thereof
A technology of Aedes dorsi and standard genes, which is applied in the identification of Aedes dorsi's DNA barcode standard genes and its application fields, can solve the problems of prolonged customs clearance period, incomplete samples, and low accuracy of morphological classification methods, and promote The effect of improving quality and improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0031]A DNA barcode standard gene used to identify Aedes dorsopoint, the nucleotide sequence (679bp) of the gene is as follows:
[0032] ATTTTATTTTCGGAGTTTGATCAGGAATAGTTGGAACATCATTAAGAATTTTAATTCGTGCTGAATTAAGTCAACCAGGTATATTCATTGGAAATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCAGATATAGCATTTCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTAACACTACTACTTTCAAGTAGTATAGTAGAAAATGGGTCAGGAACAGGGTGAACAGTTTATCCACCTCTTTCTTCTGGAACTGCTCATGCAGGAGCTTCAGTTGATTTAACAATTTTTTCTTTACATTTAGCTGGAGTATCATCAATTTTAGGAGCAGTAAATTTTATTACTACTGTTATTAATATACGATCAGCAGGAATTACTTTAGATCGATTACCTTTATTTGTTTGATCTGTTGTAATTACAGCAGTATTATTACTTTTATCATTGCCTGTTTTAGCTGGAGCTATTACTATGTTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTATTGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCTGGAAAGTTTAAA。
[0033] The molecular biology identification method for identifying Aedes dorsi using the DNA barcode standard gene for identifying Aedes dorsi comprises the following steps:...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
