Application of aldehyde dehydrogenases 1A3 and encoding gene thereof as target for preventing and treating invasion and metastasis of colorectal cancer
A technology of acetaldehyde dehydrogenase and colorectal cancer, applied in the field of biomedicine, can solve problems such as unclear molecular regulation mechanism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not indicated in the preferred embodiments are usually carried out according to conventional conditions, or according to the conditions suggested by the manufacturer.
[0033] In a preferred embodiment, the coding DNA sequence of the shRNA that inhibits ALDH1A3 gene expression is any one of the following three sequences (the underlined part is the loop sequence):
[0034] 1: gctgtattagaaccctcagatctc cgggatccaa gagatctgagggttctaatacagcttttttg (SEQ ID No. 1);
[0035] 2: gccgaatacacagaagtgaaactc cggatccaa gagtttcacttctgtgtattcggcttttttg (SEQ ID No. 2);
[0036] 3: aaccaatactgaagttcaactc cgggatccaa gagttgaacttcagtattggttgcttttttg (SEQ ID No. 3).
[0037] The construction method of ALDH1A3 gene shRNA expression vector comprises the following steps:
[0038] 1) Synthesize the foll...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
