Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs

A technology of small molecule inhibitors and dihydrofuran, which is applied in the direction of antineoplastic drugs, drug combinations, and medical preparations containing active ingredients, etc., can solve the problems of specific inhibitor research blanks, achieve reduced expression, and have great clinical significance , the effect of broad application prospects

Inactive Publication Date: 2016-08-17
GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the research on the relationship between Hotair and tumor occurrence and development is becoming more and more mature, the research on the specific inhibitor of Hotair is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs
  • Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs
  • Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0029] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0030] 1. The nucleotide sequence of Hotair (NR_003716.3)

[0031] 1 cctccaggcc ctgccttctg cctgcacatt ctgccctgat ttccggaacc tggaagccta

[0032] 61 ggcaggcagt ggggaactct gactcgcctg tgctctggag cttgatccga aagcttccac

[0033] 121 agtgaggact gctccgtggg ggtaagagag caccaggcac tgaggcctgg gagttccaca

[0034] 181 gaccaacacc cctgctcctg gcggctccca cccgggactt agaccctcag gtccctaata

[0035] 241 tcccggaggt gctctcaatc agaaaggtcc tgctccgctt cgcagtggaa tggaacggat

[0036]301 ttagaagcct gcagtagggg agtggggagt ggagagagggg agcccagagt tacagacggc

[0037] 361 ggcgagagga aggaggggcg tctttatttttttaaggccc caaagagtct gatgtttaca

[0038] 421 agaccagaaa tgccacggcc gcgtcctggc agagaaaagg ctgaaatgga ggaccggcgc

[0039] 481 cttccttata agtatgcaca ttggcgagag aagtgctgca acctaaacca gcaattacac

[0040] 541 ccaagctcgt tggggcctaa gccagtaccg acctggtaga aaaagcaacc acgaagctag

[0041] 601 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs and belongs to the field of pharmaceutical preparations containing organic effective ingredients. The chemical name of the Hotair small-molecule inhibitor is 7-nitrogen-2-[4-(7-nitrogen-3-oxy-4,9-dihydrofuran[3,2-b]quinoxaline-2-yl)phenyl]-4,9-dihydrofuran[3,2-b]quinoxaline-3-ketone, and the molecular weight is 540. The Hotair small-molecule inhibitor can specifically inhibit binding between the 5' end of Hotair and EZH2 protein in PRC2, effectively inhibit EZH2 nucleus entry in U87 cells, and effectively inhibits growth and lung metastasis of a breast cancer tumor model in an in-vivo experiment of a rat. The Hotair small-molecule inhibitor can be applied to the preparation of the tumor treating drugs, has a great clinical significance on tumor occurrence, development and treatment and has broad application prospects.

Description

technical field [0001] The invention belongs to the field of pharmaceutical preparations containing organic active ingredients, in particular to a Hotair small molecule inhibitor and its application in the preparation of drugs for treating tumors. Background technique [0002] Human Hotair is located in the region of chromosome 12q13, between the coding regions of HOXC12 and HOXC11. The initial research work began in 2007. During the study of the epigenetic regulation of the HOXA-HOXD family, Chang's research group discovered that the mechanism of action of Hotair is realized through a series of protein complexes. The first protein complex discovered is Polycomb Repressive Complex 2 (PRC2), which consists of histone H3K27 methyltransferase (H3K27 histone methyl transferase, HMTase), EZH2, EED and SUZ12. The mode of action (intrans) affects the trimethylation of lysine 27 of the H3 histone on the HOXD site, thereby inhibiting the gene transcription of the HOXD site. In rece...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07D519/00A61K31/4985A61P35/00
CPCC07D519/00
Inventor 康春生任玉王琦雪王蕴非周冰聪周俊虎
Owner GENERAL HOSPITAL OF TIANJIN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com