Unlock instant, AI-driven research and patent intelligence for your innovation.
A new rice gene wbph9(t) resistant to white-backed planthopper and its molecular marker method and application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A white-backed planthopper and molecular marker technology, applied in the field of plant molecular genetics, can solve problems such as unclear Wbph1, and achieve the effects of facilitating timely hybridization and breeding, improving the resistance level, and speeding up the breeding process.
Active Publication Date: 2019-08-23
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
McCouch et al. (1991) detected RFLP markers RG146 and RG445 that co-segregated with Wbph1, but RG146 and RG445 were multicopy markers, and no other polymorphic markers were detected. It is still unclear which chromosome Wbph1 is on
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0026] Example 1 : Obtaining molecular markers
[0027] (1) Gui 1025 / K41 F 2 Construction and phenotyping of family groups and RILs
[0028] 1. In the previous study, we used the hybridization and backcrossing of small-grain wild rice and cultivated rice IR24, combined with embryo rescue and molecular marker-assisted selection technology, to construct a set of small-grain wild rice introduction lines, which were identified and screened against white-backed planthopper. A rice line K41 with high resistance to white-backed planthopper and stable agronomic traits was obtained. In order to excavate the resistance gene in K41 and its closely linked molecular markers, the present invention takes the insect-susceptible variety Gui 1025 as the female parent and the insect-resistant strain K41 as the male parent to cross, and the obtained F 1 self-cross again, thus constructing F 2 separate groups, each F 2 The corresponding F was obtained from the individual plant through selfin...
Embodiment 2
[0045] Example 2 : Validation of molecular markers
[0046] (1) Materials and methods
[0047] Negative varieties: 30 copies. Insect-sensitive lines Gui 1025, Lemont and TN1 are all conventional rice materials preserved in the laboratory. Among the progeny of the hybrid combination Gui 1025 / K41, there are 27 susceptible families.
[0048] Positive varieties: 30 copies, and 29 copies of insect-resistant families in the descendants of the hybrid combination of the insect-resistant lines K41 and Gui 1025 / K41.
[0049] The upstream primer of the primer pair of GM21 is the sequence shown in Seq ID No.3, and the downstream primer of the primer pair is the sequence shown in SeqID No.4;
[0050] Seq ID No.3: AAAGAGATTTATAATCCAAATTTTGGCCA;
[0051] Seq ID No. 4: GCCAAAGTAATTTAGGCCTGA.
[0052] The DNA extraction method and the molecular marker analysis method are the same as in Example 1.
[0053] (2) Results
[0054]Using the above method, PCR amplification was performed on the...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a molecular marking method for tight interlocking of new gene Wbph 9 (t) for resisting rice sogatella furcifera, and application thereof. Through genetic linkage analysis, a variety F41 of the high resistant sogatella furcifera and a variety laurel 1025 of high sensitive sogatella furcifera to obtain F2 which consists of 3 family groups and recombinant inbred line groups; a rice resistant sogatella furcifera gene Wbph 9 (t) on the #6 chromosome of the rice is accurately positioned; the gene is positioned in a 120kb zone between the molecular marker MG11 and MG 32; the selecting efficiency of 1 molecular market MG21 of the zone for the antigen single plant is about 98%; the molecular market tightly interlocked by Wbph 9 (t) is applied to detect if the insect resisting variety K41 and its derivative variety (series) contains the gene; thus new material for resisting sogatella furcifera can be selected. The invention is applied to the molecular marking of the rice sogatella furcifera resistance so as to assist the seed breeding and pyramiding breeding, so as to perform the gene type selection on the low generation of breeding material in seedling period; thus the breeding efficiency is improved, and the breeding progress is accelerated.
Description
technical field [0001] The invention belongs to the field of plant molecular genetics, and relates to a new rice white-backed planthopper-resistant gene Wbph9(t) and its molecular marker and application. Background technique [0002] White-backed planthopper is an important pest in rice production. It not only directly harms rice, but also transmits other diseases and viruses during the feeding process, which seriously threatens the safety of rice production in my country. Discovering and identifying new insect-resistant genes and breeding insect-resistant varieties are the most economical and effective means of control. There are only a few reports on the localization of rice white-backed planthopper resistance genes. McCouch et al. (1991) detected RFLP markers RG146 and RG445 that co-segregate with Wbph1, but RG146 and RG445 are multicopy markers, and no other polymorphic markers were detected, so it remains unclear on which chromosome Wbph1 is located. Liu Zhiyan et al....
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
