sgRNA and vector pair for orientated knockout of nrf2 gene in human hepatocyte and application

A gene knockout, hepatocyte technology, applied in the direction of DNA/RNA fragments, introduction of foreign genetic material, vectors, etc. using vectors, can solve the problem of poor stability and repeatability of siRNA technology, can not completely eliminate Nrf2 protein, cannot exclude Nrf2 protein and other problems, to achieve the effect of excellent gene editing effect, stable morphology, and simple and easy research.

Inactive Publication Date: 2017-03-22
CHONGQING UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In traditional research methods, the principle of using siRNA interference technology to study Nrf2 function is to reduce the level of Nrf2 protein in cells by degrading the mRNA of Nrf2 in cells, but it cannot completely eliminate Nrf2 protein in cells, so the research results obtained cannot be Exclude the influence of residual Nrf2 protein; in addition, there are off-target problems in siRNA technology, and the stability and reproducibility of siRNA technology are poor; the use of homologous recombination system gene knockout technology to study Nrf2 is to knock out all or a large part of the Nrf2 gene on the genome. Fragment knockout, but this method is cumbersome to operate, and the impact of knocking out longer fragments on the genome on the genome is unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • sgRNA and vector pair for orientated knockout of nrf2 gene in human hepatocyte and application
  • sgRNA and vector pair for orientated knockout of nrf2 gene in human hepatocyte and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Selection of editing sites and design and construction of Nrf2-CAS9 plasmid

[0031] According to the gene editing principle of CAS9 technology, two CDS regions in the Nrf2 genome were selected as the Nrf2 gene CAS9 targeted editing sites. The No. 1 recognition sequence is: 5'-tatttgacttcagtcagcga-3' (SEQ ID NO.1), and the No. 2 recognition sequence The sequence is: 5'-gttgatttagacggtatgca-3' (SEQ ID NO. 2).

[0032] According to the selected target editing site, the sgRNA sequence is designed, and the sgRNA is composed of sgRNA1 that specifically recognizes the Nrf2 gene and sgRNA2 that specifically recognizes the Nrf2 gene. The sequence of the sgRNA1 is shown in SEQ ID NO. The font part is the gRNA backbone sequence), and the sequence of sgRNA2 is shown in SEQ ID NO.4 (gttgatttagacggtatgcagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttt, the bold font part is the gRNA backbone sequence).

[0033] Design Nrf2 knockout site PCR ...

Embodiment 2

[0038] Example 2 Screening, cultivation and identification of monoclonal cell lines knocked out of Nrf2 gene

[0039] 1) Nrf2-CAS9 plasmid transfected HepG2 cells:

[0040] a. HepG2 cells were planted in 2 wells of a six-well plate, which were respectively recorded as A (plasmid transfection group) and B well (control group), with 300,000 cells per well, and cultured overnight in DMEM medium. After the cells grow at the bottom of the well plate to cover about 80% of the bottom plate, prepare to transfect the Nrf2-CAS9 plasmid.

[0041] b. Aspirate the DMEM medium in wells A and B, and add 800 μL Opti-MEM.

[0042] c. Prepare solution 1, solution 2 and solution 3; among them, the formula of solution 1 is as follows: take 1.5 μg of Nrf2-CAS9-1 plasmid and 1.5 μg of Nrf2-CAS9-2 plasmid, add 100 μL Opti-MEM, mix and let stand for 5 minutes;

[0043] Solution 2: 100 μL Opti-MEM;

[0044] Solution 3: Take 18 μL of lipo2000 and add 200 μL Opti-MEM, mix well and let stand for 5 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides sgRNA and a vector pair for orientated knockout of an Nrf2 gene in human hepatocyte and application. The sgRNA consists of sgRNA1 for specifically recognizing the Nrf2 gene and sgRNA2 for specifically recognizing the Nrf2 gene; the vector pair consists of an Nrf2-CAS9-1 vector and an Nrf2-CAS9-2 vector; the Nrf2-CAS9-1 vector is a vector containing an sgNRA1 fragment; the Nrf2-CAS9-2 vector is a vector containing an sgRNA2 fragment; the vector pair can be applied to orientated knockout of the Nrf2 gene in the human hepatocyte and establishment of an Nrf2 gene knockout type human hepatocyte. By adopting the sgRNA, the vector pair and the application, the purpose of completely knocking out the Nrf2 gene at the genetic background that the length of a genome is not greatly changed can be achieved, and thus no Nrf2 protein can be retained in liver cells.

Description

technical field [0001] The invention belongs to the technical field of gene knockout, and in particular relates to sgRNA, carrier pair and application for targeted knockout of Nrf2 gene in human liver cells. Background technique [0002] Nuclear factor E2-related factor 2 (NFE2L2 / Nrf2) regulates the expression of a wide range of anti-oxidative stress genes in cells by binding to and regulating the antioxidant response element (ARE), and has a very important anti-oxidative stress function. Nrf2 is associated with the occurrence of cancer The direct relationship between the development and the migration and drug resistance of cancer cells makes the research on Nrf2 attract more and more attention from scientists. [0003] In traditional research methods, the principle of using siRNA interference technology to study Nrf2 function is to reduce the level of Nrf2 protein in cells by degrading the mRNA of Nrf2 in cells, but it cannot completely eliminate Nrf2 protein in cells, so t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N5/10
CPCC12N15/113C07K14/4702C12N15/63C12N2310/10C12N2800/80
Inventor张义国邱露
OwnerCHONGQING UNIV