A kind of pcr primer, kit and application for simultaneous detection of cyprinidae herpesvirus type Ⅰ, type Ⅱ and type Ⅲ
A detection kit and herpes virus technology, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve problems such as economic loss and infection in crucian carp breeding industry, and achieve wide applicability and practicality Good accuracy, repeatability, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: Detection CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ test of Cyprinidae herpesviruses
[0043] 1) Reagents
[0044] 10×Taq Buffer: Tris-HCl 100 mM, KCl 500 mM, MgCl 2 20 mM, dNTPs 2 mM, Taq enzyme 1 U / μL;
[0045] Primers: CyHV-F, CyHV-R, 10 μM each, pure water, positive quality control DNA 10 μg / ml;
[0046] The primer sequences are:
[0047] Upstream primer: CyHV-F: CACCTCTTGTTTTCSGCCAAC SEQ ID NO:1
[0048] Downstream primer: CyHV-R: AGGTCMGGCCTGGGCAGACC SEQ ID NO:2
[0049] Positive quality control: including the nucleic acid DNA of CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ viruses of Cynidae herpesviruses. Among them, CyHV-Ⅰ, CyHV-Ⅱ and CyHV-Ⅲ are artificially synthesized (Bosun Biotechnology (Shanghai) Co., Ltd., the same below) containing the following sequences of the target fragments amplified by the above primers:
[0050] CyHV-1: CACCTGCTCTTCTCCGCCAACAGGTGGGAGCTGGTGCCCCTGATGAAGCAGAAGCTGGAACGGGGGACGAGCCTGGTGTTGGACAGGTACGCATTCTCCGGTGTGGCATTCAGCAGCGCGAAACCTGACATGCCCGTGGAGTGGTGCAT...
Embodiment 2
[0069] Example 2: Simultaneous detection of CyHV-I, CyHV-II, and CyHV-III PCR detection primers, kits and detection methods for further effect detection.
[0070] 1. Sensitivity experiment
[0071] Dilute the above-mentioned artificially synthesized positive quality control substance, and successively dilute to 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL, respectively used as PCR templates for sensitivity experiments. see results Figure 1-3 .
[0072] figure 1 It is the sensitivity experiment result graph of CyHV-Ⅰ virus detection in the PCR system, in which the lane M is TakaraDL2000 DNA Marker, and the lanes 1-10 are positive quality control products (from 1 to 10 are 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copy / μL)), lane 11 is the negative control. It can be seen from the figure that there are clear amplified bands of about 182 bp in lanes 1-10, a...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


