A kind of pcr primer, kit and application for simultaneous detection of cyprinidae herpesvirus type Ⅰ, type Ⅱ and type Ⅲ

A detection kit and herpes virus technology, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve problems such as economic loss and infection in crucian carp breeding industry, and achieve wide applicability and practicality Good accuracy, repeatability, and high sensitivity

Active Publication Date: 2020-05-26
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2011 and 2012, CyHV-Ⅱ also infected the heterogeneous gibel carp cultured in China, causing huge economic losses to the crucian carp breeding industry in my country
At present, there is no report of a detection method based on molecular biology technology that can simultaneously and rapidly detect and distinguish three virus types of cyprinidae herpesviruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of pcr primer, kit and application for simultaneous detection of cyprinidae herpesvirus type Ⅰ, type Ⅱ and type Ⅲ
  • A kind of pcr primer, kit and application for simultaneous detection of cyprinidae herpesvirus type Ⅰ, type Ⅱ and type Ⅲ
  • A kind of pcr primer, kit and application for simultaneous detection of cyprinidae herpesvirus type Ⅰ, type Ⅱ and type Ⅲ

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Detection CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ test of Cyprinidae herpesviruses

[0043] 1) Reagents

[0044] 10×Taq Buffer: Tris-HCl 100 mM, KCl 500 mM, MgCl 2 20 mM, dNTPs 2 mM, Taq enzyme 1 U / μL;

[0045] Primers: CyHV-F, CyHV-R, 10 μM each, pure water, positive quality control DNA 10 μg / ml;

[0046] The primer sequences are:

[0047] Upstream primer: CyHV-F: CACCTCTTGTTTTCSGCCAAC SEQ ID NO:1

[0048] Downstream primer: CyHV-R: AGGTCMGGCCTGGGCAGACC SEQ ID NO:2

[0049] Positive quality control: including the nucleic acid DNA of CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ viruses of Cynidae herpesviruses. Among them, CyHV-Ⅰ, CyHV-Ⅱ and CyHV-Ⅲ are artificially synthesized (Bosun Biotechnology (Shanghai) Co., Ltd., the same below) containing the following sequences of the target fragments amplified by the above primers:

[0050] CyHV-1: CACCTGCTCTTCTCCGCCAACAGGTGGGAGCTGGTGCCCCTGATGAAGCAGAAGCTGGAACGGGGGACGAGCCTGGTGTTGGACAGGTACGCATTCTCCGGTGTGGCATTCAGCAGCGCGAAACCTGACATGCCCGTGGAGTGGTGCAT...

Embodiment 2

[0069] Example 2: Simultaneous detection of CyHV-I, CyHV-II, and CyHV-III PCR detection primers, kits and detection methods for further effect detection.

[0070] 1. Sensitivity experiment

[0071] Dilute the above-mentioned artificially synthesized positive quality control substance, and successively dilute to 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL, respectively used as PCR templates for sensitivity experiments. see results Figure 1-3 .

[0072] figure 1 It is the sensitivity experiment result graph of CyHV-Ⅰ virus detection in the PCR system, in which the lane M is TakaraDL2000 DNA Marker, and the lanes 1-10 are positive quality control products (from 1 to 10 are 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copy / μL)), lane 11 is the negative control. It can be seen from the figure that there are clear amplified bands of about 182 bp in lanes 1-10, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention discloses a PCR primer and a kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and an application of the PCR primer. The primers include CyHV-F and CyHV-R, with sequences shown as SEQ ID NO: 1 and SEQ ID NO: 2. The primer provided by the invention, when used for detection, is free from a cross reaction with other viruses and the primer is low in false positive rate; and the three cyprinid herpesviruses, namely CyHV-I, CyHV-II and CyHV-III, can be rapidly, accurately and conveniently detected and distinguished simultaneously. The invention provides a molecular biological technical basis for the early diagnosis and the prevention and treatment of the cyprinid herpesviruses. The primer has broad applicability and practicability.

Description

technical field [0001] The invention relates to aquaculture animal pathogen detection technology, in particular to a PCR primer, kit and application for simultaneous detection of Cyprinidae herpesvirus types I, II and III. Background technique [0002] In recent years, CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ have caused huge economic losses to carps aquaculture worldwide. Cyprinid herpesvirus Ⅰ (CyHV-Ⅰ), also known as Carppox herpesvirus or Herpesvirus epithelioma, often causes fish pox. Carp pox disease caused by CyHV-I was recorded as early as 1563. The disease was prevalent in Europe in the early 20th century. The disease was discovered in a fish pond in Shanghai, my country in 1957. CyHV-Ⅰ mainly harms carp over 1 year old, and also harms crucian carp, hybrids of carp and goldfish, etc., but does not harm fish such as grass carp, herring and silver carp mixed in the same pond. [0003] Cyprinid herpesvirus type II (Cyprinid herpesvirus 2, CyHV-2), also known as Goldfish haematopoieti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/705C12Q2600/158C12Q2565/125
Inventor 陈建明刘国胜陈明谅
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap