Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof

A staphylococcal gut and nucleic acid aptamer technology, which is applied in the screening process, pharmaceutical formulations, chemical instruments and methods, etc., can solve the problems of high reagent cost and poor specificity of adsorption selection, and achieve good reproducibility, small molecular weight, low cost effect

Active Publication Date: 2017-05-10
FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the purification step in this method often adopts ion exchange method or tagged affinity purification method, the former has poor adsorption selection specificity, and the latter has high reagent cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof
  • Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof
  • Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Screening of nucleic acid aptamer C203

[0048] The screening method of the nucleic acid aptamer C203 of the Staphylococcus aureus enterotoxin C2, it comprises the following steps:

[0049] (1) Preparation of the screening library: design a random ssDNA library (5'-AGGGCCGAGCTCACTTGT-N 35 -CCGCCGGCACAATTGTGC-3'), and commissioned Sangon Bioengineering Co., Ltd. to synthesize.

[0050] (2) Coupling of Staphylococcus aureus enterotoxin C2 with carboxyl magnetic beads: the Staphylococcus aureus enterotoxin C2 protein was purchased from Toxin Technology Company of the United States, and the carboxyl magnetic beads and their coupling reagents were purchased from Bangs Laboratories Company of the United States. The operation refers to the instructions provided by the manufacturer; the change of the protein concentration in the Staphylococcus aureus enterotoxin C2 solution before and after coupling is measured by the BCA method for protein concentration, and the co...

Embodiment 2

[0058] Example 2: Analysis of the nucleic acid aptamer C203 sequence:

[0059] (1) After 9 rounds of screening, the enriched ssDNA library was collected, and Shanghai Passino Biotechnology Co., Ltd. was entrusted to use high-throughput sequencing technology to analyze the library sequence. The analysis process was: PCR amplification of the enriched library, And add the sequencing adapter and Index part; select and purify the library by gel electrophoresis; use the Agilent 2100Bioanalyzer to control the quality of the library through the Agilent High Sensitivity DNA Kit; use the Quant-iT PicogGreen dsDNAAssay Kit to quantify the library; use the IlluminateNextSeq 500 platform to single The chain library is used as a template for bridge PCR amplification, sequencing primer annealing, and sequencing while synthesizing; and performing comparison and enrichment analysis on the sequencing results.

[0060] (2) Using the UNAFold network platform to analyze at 25°C, 100mM Na + , 1 mM...

Embodiment 3

[0061] Example 3: Specificity analysis of the nucleic acid aptamer C203:

[0062] (1) FAM-labeled aptamer C203 was chemically synthesized in vitro and dissolved in selection buffer.

[0063] (2) Referring to step (2) in Example 1, BSA, Staphylococcus aureus enterotoxin A, Staphylococcus aureus enterotoxin B and Staphylococcus aureus enterotoxin C1 were respectively coupled with carboxyl magnetic beads to prepare BSA magnetic beads , Staphylococcus aureus enterotoxin A magnetic beads, Staphylococcus aureus enterotoxin B magnetic beads, Staphylococcus aureus enterotoxin C1 magnetic beads and Staphylococcus aureus enterotoxin C2 magnetic beads. Wherein, the BSA was purchased from Sigma Company, and the Staphylococcus aureus enterotoxin A, Staphylococcus aureus enterotoxin B and Staphylococcus aureus enterotoxin C1 were all purchased from Toxin Technology Company of the United States.

[0064] (3) Take 200 μL of the nucleic acid aptamer C203 solution obtained in step (1) and resp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an aptamer C203 of staphylococcal enterotoxin C2, a screening method and an application thereof. The sequence of the aptamer C203 is AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGCACGGGCGGAAACGCCGCCGGCACAATTGTGC; the screening method of the aptamer C203 comprises the steps that the SELEX screening technology in vitro based on the aptamer uses carboxyl magnetic beads as a solid phase media, the staphylococcal enterotoxin C2 is used as a target, by the staphylococcal enterotoxin C2 magnetic beads, the aptamer specifically binding with the staphylococcal enterotoxin C2 is screened and obtained from the ssDNA library; the aptamer C203 is capable of binding with the staphylococcal enterotoxin C2 in a highly affiliative and highly specific mode.

Description

technical field [0001] The invention relates to a nucleic acid aptamer C203 of Staphylococcus aureus enterotoxin C2 and its screening method and application. Background technique [0002] Staphylococcus aureus enterotoxin is an exotoxin with superantigen activity secreted by Staphylococcus aureus. Staphylococcus aureus enterotoxin can be directly combined with MHC class Ⅱ molecules without restriction without being processed by antigen-presenting cells, and the complex formed can bind to the β-chain V region of T lymphocyte antigen receptors to activate T lymphocytes in large quantities, making It activates, proliferates, and releases a large amount of inflammatory cytokines to cause a strong immune response, which eventually leads to uncontrolled inflammation and damage to multiple organs, causing toxic shock and other diseases. In addition, because Staphylococcus aureus enterotoxin is more resistant to digestion, heat resistance and can trigger T cell responses with only ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12N15/10A61K31/7088A61P31/04C07K14/31G01N33/68G01N33/569
CPCC07K14/31C12N15/1048C12N15/115C12N2310/16G01N33/56938G01N33/68G01N2333/31C12N2310/531C12N2320/13C12N2330/31C12N2320/30C12Q2565/519
Inventor王开宇兰小鹏廖剑洪笑迁闫慧慧杨湘越
OwnerFUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A