96 results about "Staphylococcal Enterotoxins" patented technology

Quantification of a target analyte is performed using a single sample to which amounts of the target analyte are added. Calibration is performed as part of quantification on the same sample. The target analyte is detectable and quantifiable using label free reagents and requiring no sample preparation. Target analytes include biomarkers such as cancer biomarkers, pathogenic Escherichia coli, single stranded DNA, and staphylococcal enterotoxin. The quantification process includes determining a sensor response of a sensor exposed to the sample and configured to detect the target analyte. Sensor responses are determined after sequential additions of the target analyte to the sample. The amount of target analyte detected by the sensor when first exposed to the sample is determined in accordance with the multiple sensor responses.

The use of classical superantigens for treatment of cancer has resulted in a low response rates and serious toxicity in humans which is attributable, in part, to the presence of preformed superantigen specific antibodies in the plasma of treated patients. The present invention addresses this problem by providing a method for treating tumors comprising the administration of one or a plurality of egc (enterotoxin gene cluster) staphylococcal enterotoxins comprising staphylococcal enterotoxins G, I, M, N, O. These superantigens in native unmodified form can be administered intrathecally, intratumorally, intravenously to humans with advanced lung cancer while resolving pleural effusions and prolonging survival to 300% above control patients treated with talc pleurodesis. Intratumoral egc superantigens induces a significant and sustained reduction of the tumor size. In contrast to classic Sags, the egc superantigens induced minimal toxicity, are rarely associated with the presence of preformed antibodies and are used as a plurality with a broad T cell Vβ profile. Useful egc superantigen compositions for parenteral administration native egc enterotoxins, homologues, fragments and fusion proteins of native egc enterotoxins capable of activating a broad spectrum of T cells expressing T cell receptor/α motifs. T cell survival-enhancing cytokines IL-7, Il-15, Il-23 are used. together with parenteral egc SE therapy. Also disclosed is combined therapy that includes parenteral, intratumoral or intrathecal superantigen compositions in combination with (i) intratumoral low, non-toxic doses of one or more chemotherapeutic drugs or (ii) systemic chemotherapy at reduced and non-toxic doses of chemotherapeutic drugs or (iii) radiation therapy or (iv) anti-angiogenic and tyrosine kinase inhibitors.

The invention belongs to the technical field of biology, and particularly discloses function epitopes 195SFWYDMMP202, 12HKSSKFTGL20, 18TGLMEN23 and 43QFLFYFIY51 of staphylococcal enterotoxin B (SEB), monoclonal antibodies 4A3 and 3E2 specifically bound with the function epitopes and application of the monoclonal antibodies in the preparation of drugs for treating SEB-induced toxic shock syndrome.

A staphylococcal enterotoxin detection method is characterized in that the detection method comprises the steps as follows: (1) preparing an LSPR detection chip of staphylococcal enterotoxin; (2) activating the surface of the metal structure of the chip to form a specific biological molecular membrane; (3) testing the extinction spectrum of the chip to obtain a reference value before combination; and (4) dripping a to-be-detected sample, putting the sample in an LSPR sensor for detection after the full reaction of the sample, observing spectral shift condition by using the specific reaction among antigen-antibody molecules, and judging whether the to-be-detected sample contains staphylococcal enterotoxin, so as to realize fast detection with high sensitivity and without a label. The method does not need complex equipment and does not use radioactive isotope, enzyme or fluorescence and the like as a label, and has the remarkable characteristics of quickness, high sensitivity, wide application range, security and high stability. The method provides a simple and practical new method for the quick detection of staphylococcal enterotoxin.

The invention discloses a staphylococcal enterotoxin gene engineering reshaped antibody and its preparation method and use. The staphylococcal enterotoxin gene engineering reshaped antibody has an amino acid sequence shown in the formula of SEQ ID No.1 in the sequence table. Through construction of light and heavy chain eukaryotic co-expression vectors of the staphylococcal enterotoxin monoclonal antibody, a high-efficiency expression and stable-secretion mammalian cell line and the gene engineering reshaped antibody having high singularity and strong affinity are obtained. The staphylococcal enterotoxin gene engineering reshaped antibody can be used in staphylococcal enterotoxin detection, cell indirect immunofluorescence detection and flow cytometry detection.

The invention discloses a staphylococcal enterotoxin micromolecule antibody and its preparation method and use. The staphylococcal enterotoxin micromolecule antibody has an amino acid sequence shown in the formula of SEQ ID No.1 in the sequence table. The preparation method comprises the following steps of designing and constructing eukaryotic mono-promoter co-expression vectors of staphylococcal enterotoxin monoclonal antibody light chain and heavy chain variable region genes, introducing cysteine residues to C- ends of the light chain and the heavy chain to form interchain disulfide bonds by an intracellular peptide fragment self-assembling principle, and simulating antigen binding domain spatial conformation of natural antibodies to obtain high-efficiency expression stable-secretion mammal cell line and the high-singularity strong-affinity micromolecule antibody. The staphylococcal enterotoxin micromolecule antibody can be used for staphylococcal enterotoxin detection, cell indirect immunofluorescence detection and flow cytometry detection.

The invention discloses an immune chromatographic indicator paper and making method of B-typed staphylococcus aureus enterotoxin, which comprises the following parts: sample pad 1, metal pad 2 with specific antibody mark colloidal gold probe of B-typed staphylococcus aureus enterotoxin in connection with one end of sample pad tightly, nitric fiber film (NC film) 3 in connection with the other end of metal pad tightly, water-absorbing pad 4 in connection with the other end of nitric fiber film tightly, wherein the nitric fiber film covers mutually separated detecting line 5 and quality control line 6, which is specific antibody of B-typed staphylococcus aureus enterotoxin and sheep-anti-rabbit lgG separately.

The invention provides primers designed on base of the difference of sequences among staphylococcal enterotoxin subtypes, i.e., C₁, C₂ and C₃. The invention also provides a PCR method for detecting subtypes of staphylococcal enterotoxin type C by using the above-mentioned primers. The invention relates also to DNA probes useful for the identification of subtypes C₁, C₂ and C₃ of staphylococcal enterotoxin type C in various food and clinical samples. The primers of the invention comprises following sequences:

The invention discloses an antibody against staphylococcal enterotoxin B and application thereof. The heavy chain of the antibody against staphylococcal enterotoxin B has variable regions CDR1, CDR2 and CDR3 of which the amino acid sequences are shown in SEQ ID NO. 5, SEQ ID No. 6 and SEQ ID No. 7, or is composed of CDR variants with equivalent functions; and light chain of the antibody against staphylococcal enterotoxin B has variable regions CDR1, CDR2 and CDR3 of which the amino acid sequences are shown in SEQ ID NO. 9, SEQ ID No. 10 and SEQ ID No. 11, or is composed of CDR variants with equivalent functions. The antibody against staphylococcal enterotoxin B is capable of specifically binding with staphylococcal enterotoxin B or free enterotoxin B; and thus, the antibody can be used fortreating, preventing and diagnosing staphylococcus aureus infection. Therefore, the antibody against staphylococcal enterotoxin B will be an important research direction in the fields of "non-antibiotic" treatment of methicillin-resistant staphylococcus aureus infection and drug resistance development control.

The invention relates to a protein G staphylococcus aureus enterotoxin kit and a preparation method thereof. Protein G is adopted to preprocess an enzyme labeling plate, and quick and accurate detection on staphylococcus aureus enterotoxin A/B is realized by combining with an ELISA double-antibody sandwich method. The kit consists of the 96-hole enzyme labeling plate, a staphylococcus aureus enterotoxin A-resistant protein G recombinant protein monoclonal antibody, a staphylococcus aureus enterotoxin B-resistant monoclonal antibody, a staphylococcus aureus enterotoxin antibody enzyme labeling object containing a horseradish peroxidase label, a sample diluent, a cleaning solution and a stop buffer. The protein G staphylococcus aureus enterotoxin kit can quickly and effectively detect the residual level of tony red in a to-be-detected sample, and also has the characteristics of simple operation, good specificity, high sensitivity, and the like.

The invention discloses a staphylococcus aureus enterotoxin B nanometer antibody B7, an application and a reagent kit. The obtained nanometer antibody has small relative molecular mass, strong stability and high yield, can specially recognize SEB, and is broader in use and higher in specificity compared with a conventional monoclonal antibody. The invention discloses the nanometer antibody and a gene sequence for coding the nanometer antibody, a method for producing the nanometer antibody, and a reagent kit applying the antibody. The obtained nanometer antibody can prevent combination with surface protein A of the staphylococcus aureus, shows higher specificity, has good stability and small molecular weight, and can realize mass production.

The invention discloses a genotype inspection method and a genotyping inspection method of staphylococcal enterotoxin. The genotype inspection method of staphylococcal enterotoxin includes the steps of sample treatment, DNA extraction, PCR and PCR amplified product analysis. The amplified sample is put in agarose gel including ethidium bromide for electrophoresis and color development and observed under a transmissive uviol lamp; the inspected sample can be judged as a positive sample including corresponding staphylococcal enterotoxin genotype if the length of the amplified nucleic acid band is the same as the amplified length in table 2. The first method can fast inspect the particular staphylococcal enterotoxin genotype, with high sensitivity, high particularity and high accuracy. The second method can achieve systematic genotyping of staphylococcal enterotoxin genes from different sources and provide technical support for analysis of relationships among different enterotoxin types. The invention is significant in food security quarantine, disease diagnosis and molecular epidemiology research.

The present invention discloses an immune chip for detecting staphylococcal enterotoxin and papaverina dn its preparation process. The immune chip has slide glass with surface treated with silane as aldehydation reagent and crosslinked with glutaraldehyde as double-function crosslinking reagent, and connected via covalent bond with the molecule of at least one kind of antibody staphylococcal enteriotoxin A antibody, staphylococcal enterotoxin B antibody, staphylococcal enterotoxin C antibody and papaverine antibody. The detection with the immune chip is simple, effective and low in cost.

A prophylactic/remedy for immunopathy for immunopathy comprising, as an active ingredient, modifications of Staphylococcal enterotoxin B (SEB) with substitution of at least one amino acid residues within the amino acid sequence of natural type SEB, or derivatives thereof, wherein the SEB modifications or derivatives thereof have inhibitory activity on T cell activation wherein they interact with specific Vβ component of T cell receptor (TCR) but are reduced in their immunological responsiveness to SEB without inducing elimination of T cells having specific Vβ component, the elimination being normally induced by natural type SEB or recombinant wild-type SEB.

The invention aims to provide a protein suspension chip capable of quantificationally detecting bacterial toxin and the preparation method thereof, and particularly relates to a protein suspension chip which is suitable for quantificationally detecting and analyzing staphylococcal enterotoxin. The method has high sensitivity and high particularity, good detection capacity and wide dynamic range and builds a novel detection modularity platform.

The invention relates to a preparation method of a monoclonal antibody for simultaneous detection of staphylococcal enterotoxins A and B (referred to as SEA and SEB). The SEA and SEB commonly caused staphylococcal poisoning are used as immunogens, and the monoclonal antibody for simultaneous detection of SEA and SEB is prepared via a mixed immunization method, a hybridoma technology and screening in an indirect ELISA (enzyme-linked immunosorbent assay, referred to as ELISA) method. The monoclonal antibody can be used for simultaneously detecting the SEA and SEB in food via one-step reaction, and thus the workload of analysis of staphylococcal food poisoning can be reduced.

A reagent bar used for quickly detecting staphylococcus enterotoxin consists of reagent, reagent bar and micro-scale pipet. It is featured as using cell clasmatosis solution as reagent and carrying 20 micron L of specific single clone antibody of anti-staphylococcus enterotoxin, collaurum labeled single clone antibody of anti-staphylococcus enterotoxin, collaurum labeled quality control antigen and antibody of relevant antigen on reagent bar.

The invention discloses a detection test paper. The test paper comprises (1) a reaction support, (2) a water absorption pad, (3) a nitrocellulose membrane, (4) a gold-labeled antibody adsorption membrane and (5) a sample pad, wherein the nitrocellulose membrane is coated with a detection strip and a quality control strip of a staphylococcal enterotoxin B antibody and a quality control antibody; and the gold-labeled antibody adsorption membrane contains the staphylococcal enterotoxin B antibody labeled by colloidal gold. The test paper can be matched with a small instrument to carry out semi-quantitative detection, does not need professional training, has clear and identifiable result, can objectively store data, is simple to operate, easy to popularize, suitable for a basic level, suitable for field detection of emergency and suitable for epidemiological investigation, and plays an auxiliary role in diagnosis of staphylococcal enterotoxin B infection.

The invention discloses an AlphaLISA detection kit for type B staphylococcal enterotoxin (SEB). The AlphaLISA detection kit provided by the invention comprises an SEB capturing antibody labeled receptor microsphere, a biotin labeled SEB detection antibody and a streptavidin labeled donor microsphere. The invention further provides a detection method of the type B staphylococcal enterotoxin; the detection method of the type B staphylococcal enterotoxin, provided by the invention, is used for detecting the type B staphylococcal enterotoxin by adopting an AlphaLISA technology. An experiment proves that the detection method of the type B staphylococcal enterotoxin can be used for greatly reducing influences on protein A; the detection method provided by the invention is rapid, accurate and reliable and has a good application prospect.

The invention discloses a magnetic particle chemiluminescence assay kit and a method for detecting SEA, and belongs to the technical field of food safety detection. The method is a magnetic particle chemiluminescence assay method for fast detecting SEA in foods and preparations. The method comprises the following steps of diluting a standard substance, adding a marker into the dilute standard substance, carrying out uniform mixing, warm bath, sedimentation and washing, adding a luminous substrate into the mixture, determining chemiluminescence intensity, drawing a standard curve, wherein an OD value of a detected sample is in the range of the standard curve. The magnetic particle chemiluminescence assay kit has the advantages of simple operation, fast speed, high sensitivity, strong singularity and low cost.

The invention discloses an antibody or an active fragment thereof specifically combined with staphylococcus aureus enterotoxin B, colloidal gold immunochromatographic detection test paper or a kit containing the antibody, and a preparation method and application thereof. The detection test paper or kit is convenient to produce, stable in effect, free of non-specific reaction, low in coating amountand beneficial to mass production. The detection method of the staphylococcus aureus enterotoxin B provided by the invention has the advantages of rapidness, sensitivity, simplicity, convenience, specificity and the like, and has wide application in food safety detection and monitoring.

Pyrogenic toxins, such as staphylococcal enterotoxins, modified in the disulfide loop region are provided. The modified toxins retain useful biological properties but have substantially reduced toxicity compared to the corresponding unmodified native toxin. The native pyrogenic toxins are typically modified by deletions within the disulfide loop region to produce modified enterotoxins having 100-fold or greater decrease in toxicity.

The invention belongs to the field of molecular detection for microbial toxin in food science and technology, in particular to rapid detection and parting of 11 serotypes of staphylococcal enterotoxin in food by applying the flows such as total DNA component extraction and SYBRGreen fluorescent quantitative PCR (polymerase chain reaction) rapid detection. Results show that the staphylococcal enterotoxin in food can be effectively typed according to the situation whether marked amplification curves appear in 35 PCR cycles by utilizing the method, thus the method has the characteristics of specificity aiming at enterotoxin genes of different serotypes, sensitivity, accuracy, rapidness and convenience and the like; and compared with the existing method, the method provided by the invention has the advantages of greatly improving the detection and parting efficiency and providing a new way for risk analysis of food pollution caused by the staphylococcal enterotoxin of different types.

The invention relates to an aptamer C201 of staphylococcal enterotoxin C2 as well as a screening method and application of aptamer C201. The aptamer C201 has a sequence of AGGGCCGAGCTCACTTGTACATAGGTCCATTAGCAGGAGCGTAAGCTAAGGCCCCGCCGGCACAATTGTGC. The screening method comprises the following steps: utilizing carboxyl magnetic beads as solid phase media based on an in-vitro SELEX screening technology of the aptamer, taking staphylococcal enterotoxin C2 as a target, screening from an ssDNA library by virtue of the staphylococcal enterotoxin C2 magnetic beadsso as to obtain the aptamer which is specifically bound to the staphylococcal enterotoxin C2. The aptamer C201 disclosed by the invention has the advantage of binding with the staphylococcal enterotoxin C2 at high affinity and high specificity.