Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use
A technology for staphylococcal intestinal and immune preparations, applied in the directions of botanical equipment and methods, biochemical equipment and methods, and applications, can solve problems such as allergic reactions, aseptic suppuration, granulomas, etc., and achieve great development and utilization value. , the effect of enhancing immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: SEB1 gene amplification and pET28a vector connection
[0041] The amino acids of SEB were searched through the protein database and translated into DNA sequences, and amplification primers were designed for it. The upstream primer was marked as P1, and the downstream primer was marked as P2. And NdeI restriction site and EcoRI restriction site were introduced into the N-terminus of SEB1 fragment. Using (SEB full gene sequence SEQ ID NO.1, synthesized by Dalian Bao Biotechnology Co., Ltd.) as template, P1 and P2 as primers for amplification reaction, the obtained PCR product is labeled as SEB1;
[0042] P1 (31bp): 5′CATGCATATGGAAAGCCAGCCGGATCCGAAA 3′ contains NdeI restriction site;
[0043] P2 (23bp): 5′GCGAATTCTCATTTTTTGGTGGTCAGATACACTTC 3′contains an EcoRI restriction site;
[0044] Gene fragments were amplified by conventional methods; analyzed by agarose gel electrophoresis, the results were shown in figure 1 As shown in ., the target gene with a size ...
Embodiment 2
[0046] Embodiment 2: Connection of recombinant plasmid pET28a-SEB2-HSP65
[0047] According to the sequence of the gene, primers with restriction sites at both ends were designed to amplify the target gene; the upstream primer was marked as P3, and the downstream primer was marked as P4; NdeI restriction site and C-terminal were introduced at the N-terminus of SEB EcoRI cleavage site; use (contains the full gene sequence of SEB SEQ ID NO.1, synthesized by Dalian Bao Biotechnology Co., Ltd.) as a template, P3 and P4 as primers for amplification reaction, and the obtained PCR product is labeled as SEB2;
[0048] P3 (34bp): 5′CATGCATATGAGCATTGATCAGTTTCTGTATTTT 3′contains NdeⅠ restriction site;
[0049] P4 (26bp): 5′GCGAATTCATCGCCCGGCGCCGGCAT 3′contains EcoRI restriction site;
[0050] Amplify the gene fragment of SEB2 with conventional PCR method, agarose gel electrophoresis analysis, the result is as follows image 3 As shown in ., the target gene with a size of about 500bp ca...
Embodiment 3
[0056] Embodiment 3: SDS-PAGE result of SEB1 protein and SEB2-HSP65 recombinant protein expression product
[0057] The recombinant plasmids pET28a-SEB1 and pET28a-SEB2-HSP65 were respectively transformed into the expression bacteria-Escherichia coli BL21 (DE3), and the expression was induced by IPTG. The results of SDS-PAGE showed that the recombinant proteins SEB1 and SEB2-HSP65 were at about 30KD and 80KD respectively. There is an obvious expression band, the size is consistent with the theoretical value; see Image 6 and 7 ;
[0058] Perform SDS-PAGE electrophoresis at the same time on the supernatant of the SEB1 protein-expressing bacteria lysate and the precipitate. The results show that most of the SEB1 protein is in the supernatant, and there is also a small amount of target protein in the corresponding position in the precipitate, which is considered to be soluble expression. See Image 6 .
[0059] The SEB2-HSP65 recombinant protein expressing bacteria lysate supe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 