Unlock instant, AI-driven research and patent intelligence for your innovation.

Aid-expression sequence and application thereof in acellular expression of ADCY2 protein

A cell-free, sequence table technology, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, lyase, etc., can solve the problem of low protein expression in cell-free, achieve high protein expression, and solve low protein expression Effect

Inactive Publication Date: 2017-05-31
WUHAN GENECREATE BIOLOGICAL ENG CO LTD
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the problems existing in the prior art, the purpose of the present invention is to provide a helper expression sequence and its application in cell-free expression of ADCY2 protein, which can solve the problem of low expression of cell-free protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aid-expression sequence and application thereof in acellular expression of ADCY2 protein
  • Aid-expression sequence and application thereof in acellular expression of ADCY2 protein
  • Aid-expression sequence and application thereof in acellular expression of ADCY2 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. Optimizing the codon of the ADCY2 gene, the optimized codon sequence is shown in Sequence Table 2, adding the expression-helping sequence B-tag (ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAATTTCCTGAATTGCTAT; the amino acid sequence is IQRTPKIQVYSRHPAENGKSNFLNCY) in the N segment of the ADCY2 gene after codon optimization. A 10×his (serine) tag (CATCATCATCATCATCATCATCATCATCAT; HHHHHHHHHHH) was added to the end, and the entire sequence was synthesized as a template for gene cloning.

[0031] 2. Take the target fragment containing the B-tag and 10×his tag synthesized above as the template of the PCR reaction, and design the upstream primer (5'-ATGCT CCATGG ATCCAGCGTACTCCAAAAGATT-3') and the downstream primer (5'-GGGCC CTCGAGATGATGATGATGATGATGATGATGATGATGATG-3'). Take 4.0 μL template, 2 μL 10 μmol / L upstream and downstream primers, 1.0 μL DNA polymerase (5 U / μL), 10 μL 10×DNA polymerase buffer, and 5.0 μL dNTP mixture as the PCR reaction system. Adjus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aid-expression sequence and application thereof in acellular expression of an ADCY2 protein, which belong to the field of biotechnology. An amino acid sequence of the aid-expression sequence is as shown in a sequence table SEQ ID1 or is the amino acid sequence with at least 75 percent of homology. The aid-expression sequence is mainly applied in acellular expression of a multiple membrane-spanning protein. The aid-expression sequence and the application thereof in the acellular expression of the ADCY2 protein provided by the invention can solve the problem of low acellular protein expression quantity.

Description

technical field [0001] The invention relates to the field of cell-free expression, in particular to an expression-helping sequence and its application in cell-free expression of ADCY2 protein. Background technique [0002] Structural and functional analysis requires a large number of membrane protein samples, but a bottleneck is how to obtain membrane proteins in large quantities and efficiently. Cell-free expression systems are coupled transcription-translation systems that reduce the complexity of expressing proteins. The strategy of using helper sequences can lead to rapid improvement of cell-free expression efficiency based on the optimization of translation initiation. High-frequency use of rare codons and unfavorable initiation of translation have been identified as major limiting steps in protein biosynthesis, and formation of secondary structures involving high-risk secondary structures in 5' regions of mRNA such as ribosome binding sites can be slowed down or even ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/47C12N9/88C12N15/70
CPCC07K14/4705C12N9/88C12N15/70C12N2800/101C12N2800/22C12Y406/01001
Inventor 华权高沈鹤霄易汪雪王静
Owner WUHAN GENECREATE BIOLOGICAL ENG CO LTD