Aid-expression sequence and application thereof in acellular expression of ADCY2 protein
A cell-free, sequence table technology, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, lyase, etc., can solve the problem of low protein expression in cell-free, achieve high protein expression, and solve low protein expression Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] 1. Optimizing the codon of the ADCY2 gene, the optimized codon sequence is shown in Sequence Table 2, adding the expression-helping sequence B-tag (ATCCAGCGTACTCCAAAGATTCAGGTTTACTCACGTCATCCAGCAGAGAATGGAAAGTCAATTTCCTGAATTGCTAT; the amino acid sequence is IQRTPKIQVYSRHPAENGKSNFLNCY) in the N segment of the ADCY2 gene after codon optimization. A 10×his (serine) tag (CATCATCATCATCATCATCATCATCATCAT; HHHHHHHHHHH) was added to the end, and the entire sequence was synthesized as a template for gene cloning.
[0031] 2. Take the target fragment containing the B-tag and 10×his tag synthesized above as the template of the PCR reaction, and design the upstream primer (5'-ATGCT CCATGG ATCCAGCGTACTCCAAAAGATT-3') and the downstream primer (5'-GGGCC CTCGAGATGATGATGATGATGATGATGATGATGATGATG-3'). Take 4.0 μL template, 2 μL 10 μmol / L upstream and downstream primers, 1.0 μL DNA polymerase (5 U / μL), 10 μL 10×DNA polymerase buffer, and 5.0 μL dNTP mixture as the PCR reaction system. Adjus...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


